|
Items in cart [1] |
Questions? Call 888-624-8373 |
| Copyright © 2009. National Academy of Sciences. All rights reserved. Terms of Use and Privacy Statement |
Below are the first 10 and last 10 pages of uncorrected machine-read text (when available) of this chapter, followed by the top 30 algorithmically extracted key phrases from the chapter as a whole.
Intended to provide our own search engines and external engines with highly rich, chapter-representative searchable text on the opening pages of each chapter.
Because it is UNCORRECTED material, please consider the following text as a useful but insufficient proxy for the authoritative book pages.
Do not use for reproduction, copying, pasting, or reading; exclusively for search engines.
OCR for page 38
Colloquium
,.
Neuroectodermal differentiation from mouse
multipotent adult progenitor cells
Yuehua Hang*, Dori Hendersont, Mark Blackstad*, Angel Chen*, Robert F. Millert, and Catherine M. Verfaillie*:
*Stem Cell Institute and Division of Hematology, Department of Medicine, and Department of Neuroscience, University of Minnesota Medical School,
Minneapolis, MN 55455
We recently showed that a rare cell from murine bone marrow,
which we termed multipotent adult progenitor cells (MAPCs), can
be expanded for >120 population doublings. Mouse (m)MAPCs
differentiate into mesenchymal lineage cells as well as endothe-
lium and endoderm, and, when injected in the blastocyst, mMAPCs
contribute to most if not all somatic cell lineages including the
different cell types of the brain. Our results, reported herein,
demonstrate that mMAPCs can also be induced to differentiate
into cells having anatomical and electrophysiological characteris-
tics similar to those of midbrain neurons. Differentiation to a
neuronal phenotype was achieved by coculturing mMAPCs with
astrocytes, suggesting that neuronal differentiation may require
astrocyte-derived factors similar to what is required for the dif-
ferentiation of embryonic stem cells and neural stem cells to
neurons. Differentiation of mMAPCs to neuron-like cells follows
similar developmental steps as described for embryonic stem cells
and neural stem cells. MAPCs therefore may constitute a source of
cells for treatment of central nervous system disorders.
~ ~ ntil recently it was thought that tissue-specific stem cells
V could only differentiate into cells of the tissue of origin.
However, several recent studies suggest that tissue-specific stem
cells may be able to differentiate into cells of different tissues.
For instance, cells infused at the time of bone marrow (BM)
transplantation contribute to skeletal muscle myoblasts (1, 2)
and endothelium (3-7) acquire properties of hepatic (8-10),
biliary duct (8-10), lung, gut, and skin epithelia (11) as well as
neuroectoderm (12, 134. When injected in the heart, BM cells
acquire a cardiac myoblast phenotype (6~. Neural stem cells
(NSCs) may repopulate the hematopoietic system (14, 15), and
muscle cells may differentiate into hematopoietic cells (16, 174.
What mechanists) is responsible for this apparent plasticity is
not known.
We recently showed that a rare cell, which we termed the
multipotent adult progenitor cell (MAPC), within mesenchymal
stem cell cultures from rodent BM can be expanded for >120
population doublings (18-20~. This cell differentiates not only
into mesenchymal lineage cells but also endothelium and
endoderm. We also showed that mouse (m)MAPCs injected in
the blastocyst contribute, similar to embryonic stem (ES) cells,
to most if not all somatic cell lineages including the brain. Within
the brain, region-specific appropriate differentiation occurred
(21~. We show here that similar to mES cells, mMAPCs can also
be induced to differentiate in vitro into cells with biochemical,
anatomical, and electrophysiological characteristics of midbrain
neuronal cells.
Methods
Generation of MAPCs. BM was collected from femurs of 3- to
4-week-old 129 x C57BL/6J ROSA26 mice according to guide-
lines from the University of Minnesota Institutional Animal
Care and Use Committee. MAPCs were generated as described
(20~. To demonstrate that cells were MAPCs, they were induced
11854-11860 1 PNAS 1 September30, 2003 1 vol.100 1 suppl.1
to differentiate to endothelium and hepatocyte-like cells as
described (18, 20~. In addition, we showed that these cell
populations contributed to most somatic cells of the mouse after
blastocyst injection (204.
Neuroectodermal Differentiation of MAPCs. Base medium consisted
of 60% DMEM-low glucose (GIBCO/BRL), 40% MCDB-201
(Sigma) with lx insulin-transferrin-selenium, lx linoleic acid
BSA, 10-9 M dexamethasone (Sigma), and 10-4 M ascorbic acid
2-phosphate (Sigma), 100 units of penicillin, and 1,000 units of
streptomycin (GIBCO) on fibronectin (Sigma). In some in-
stances we also added N2 supplement (GIBCO). Cytokines
added included 100 ng/ml basic fibroblast growth factor (bFGF),
100 ng/ml Sonic Hedgehog (SHH), 10 ng/ml FGF8, and 10
ng/ml brain-derived neurotrophic factor (BDNF) (all from
R & D Systems). All experiments were repeated at least three
times by using different subpopulations from a single MAPC cell
line. MAPCs had been expanded for 50-70 population doublings
before use in neuroectodermal differentiation.
Astrocyte Preparation. Mouse brain was dissected from embryonic
day (E)16 fetuses in Hanks' balanced salt solution (HBSS,
Sigma). The dissected brain was minced and incubated in 0.125%
trypsin/0.05% DNase (Sigma) in HBSS at 37°C for 20 min. The
tissue was triturated with a pipette and dissociated to a mixture
of sincle cells and small cellular aggregates. After passing
through a 70-,um nylon mesh, the cells were centrifuged at
300 x g for 5 min and resuspended in DMEM plus 10% FBS
(HyClone). Cells were plated onto culture dishes, precoated with
poly-D-lysine (100 ,ug/ml, Sigma) at 4°C overnight, at a density
of 60O,OOO cells per cm2 until confluent.
Astrocyte-Conditioned Medium. After astrocytes had been cultured
in DMEM plus 10% FBS for 8 days, culture medium was
switched to serum-free medium supplemented with N2 supple-
ment. Three days later, the medium was collected as astrocyte-
conditioned medium.
Coculture of MAPC-Derived Neurons with Fetal Brain Astrocytes.
Glass coverslips were coated with 500 ,ug/ml poly-D-lysine
overnight at 4°C. Fetal brain astrocytes that have been cultured
This paper results from the Arthur M. Sackier Colioquium of the Nationai Acaclemy of
Sciences, "Regenerative Meclicine," heicl October 18-22, 2002, at the Arnoicl ancl Mabei
Beckman Center of the Nationai Acaclemies of Science ancl Engineering in Irvine, CA.
Abbreviations: BM, bone marrow; NSC, neural stem ceil; MAPC, muitipotent acluit progen-
itor ceil; m, mouse; ES, embryonic stem; FGF, fibrobiast growth factor; bFGF, basic FGF; SHH,
Sonic Hecigehog; BDNF, brain-clerivecl neurotrophic factor; En, embryonic clay n; NF,
neurofiiament; MBP, myeiin basic protein; TH, tyrosine hyciroxylase; DDC, clopa-clecarbox-
ylase; TrH, tryptophan hyciroxylase; GABA, y-aminobutyric acicl; GFAP, gliai fibriiiary aciclic
protein; TTX, tetroclotoxin; PDGF, piateiet-clerivecl growth factor; eGFP, enhancecl GFP.
iTo whom corresponclence shouicl be aciciressecl at: University of Minnesota, MMC 716,
422 Deiaware Street SE, Minneapolis, MN 55455. E-maii: verfa001C?umn.eclu.
2003 by The Nationai Acaclemy of Sciences of the USA
www.pnas.org/cgi/doi/10.1073/pnas.1834196100
OCR for page 39
Table 1. Primers used for quantitative RT-PCR
Gene Forward Reverse Size, bp
Sox-1 AAGATGCACAACTCGGAGATCAG TGTAATCCGGGTGTTCCTTCAT 51
Otx-2
Otx-1
Pax-2
Pax-S
Ptx-3
cRet
,.
., .
CCATGACCTATACTCAGGCTTCAGG
Nurr- 1
Nestin
GFAP
MBP
GABA
DAT
TH
TrH
DBH
AGGCGCTGTTCGCAAAGA
CCAGGCATCAGAGCACATCA
AAACGCAAGAGGGATGAAGGT
TGTGTGGCACCTGGAGTTCA
GAGGAAATGTACCGTCTGATGCT
TGAAGAGAGCGGAGAAGGAGATC
GAGAAGACAGTGAGGCAGATGAGTTA
GAGGAGTGGTATCGGTCTAAGTTTG
GTGCAGCTTGTTCGACTCCG
AGGTTGACCGTGAGAGCTGAAT
GCAATCATCACCACCTCCATTA
AGTTCTCCCAGGACATTGGACTT
GGATGGAGTCTGATGTCACCAA
TTCCAATGTGCAGCTGAGTC
for 8 days were trypsinized, replated on glass coverslips, and
allowed to grow to confluency. Once confluent, the coverslips
were evaluated for the presence of neurons by staining with
antibodies against neurofilament (NF)-200 (see methods below)
or placed upside down in cultures of MAPC-derived neuron-like
cells. Cultures were maintained in serum-free medium supple-
mented with N2 supplement and without additional cytokines
for 5-12 days.
Lentivirus Transduction. mMAPCs were seeded at 105 cells per well
in six-well tissue-culture plates. One milliliter of MAPC culture
medium, 1 ml of supernatant of the 293 cell line transfected with a
third generation VSV-g-pseudotyped eGFP lentivirus (107 infec-
tious particles per ml) (a kind gift from Thierry Vandendriesche,
Katholieke Universiteit Leuven, Leuven, Belgium) and polybrene
(8 ,ug/ml final concentration), was added to the wells. After 6 h of
incubation at 37°C and 5% CO2, the medium was replaced with
fresh MAPC medium. Transduction of MAPCs was repeated three
times. Transduction efficiency of the final population was 28% as
determined by counting 200 cells.
Quantitative RT-PCR for Neuronal Transcription Factors and Genes.
RNA was extracted from MAPCs, MAPCs differentiated for 5,
7, 10, 14, and 21 days, and brain from E18 or adult mice by using
the RNeasy kit (Qiagen, Valencia, CA). Contaminating DNA
was eliminated by two sequential steps of DNase (Invitrogen)
treatment. mRNA was reverse-transcribed, and cDNA under-
went 40 rounds of amplification (ABI PRISM 7700, Perkin-
Elmer/Applied Biosystems) with reaction conditions of 40 cycles
of a two-step PCR (95°C for 15 min and 60°C for 60 min) after
initial denaturation (95°C for 10 min) with 2 ,ul of DNA solution
and 1 x SYBR green PCR master mix reaction buffer (Applied
Biosystems). Controls consisted of amplifications without re-
verse transcription and reactions without addition of cDNA
template. The authenticity and size of PCR products were
confirmed by melting curve analysis (using software provided by
Perkin-Elmer) and gel analysis. Primers used and the size of
expected products are shown in Table 1. mRNA levels were
normalized by using GAPDH as housekeeping gene and com-
pared with levels in E18 or adult mouse brain.
Immunophenotypic Analysis. Cells were fixed with 4% paraformal-
dehyde (Sigma) for 4 min at room temperature followed by
methanol (Sigma) for 2 min at -20°C. For nuclear li~ands, cells
were permeabilized with 0.1 M Triton X-100 (Sigma) for 10 min.
Slides were incubated sequentially for 30 min each with primary
Jiang et al.
GAAGCTCCATATCCCTGGGTGGAAAG
CCTCCTCGCGCATGAAGAT
CGTCTGTGTGCCTGACACATT
AACAGGTCTCCCCGCATCT
CACCCTCAGGAACAGAGTGACTT
TCTTGACCATCATCTTCTCCAGATC
TCTGGAGTTAAGAAATCGGAGCTG
GCCTCTGTTCTCCAGCTTGCT
GCCGCTCTAGGGACTCGTT
ATGCTCTCTGGCTCCTTGGC
TGGGCAGGCATGGGC
ATGGGCACATTGTGCTTCTG
ACACAGCCCAAACTCCACAGT
TGACGTTTCTCAGGCATTAAGC
GGTGCACTTGCTTGTGCAGT
211
50
141
100
107
102
255
1 1 3
165
153
68
100
100
120
242
antibody and fluorescein or Cy3- or CyS-coupled anti-mouse-,
goat-, or rabbit-IgG antibodies. Between each step, slides were
washed with PBS plus 1% BSA (Sigma). Cells were examined by
confocal fluorescence microscopy (Confocal 1024 microscope,
Olympus AX70, Olympus Optical, Tokyo). To assess the fre-
quency of different cell types in a given culture, we counted the
number of cells staining positive with a given antibody in four
visual fields (50-200 cells per field).
Antibodies against myelin basic protein (MBP, 1:20), NF-200
(1:400), microtubule-associated protein (1:400), tyrosine hydrox-
ylase (TH, 1:1,000), dopa-decarboxylase (DDC, 1:100), trypto-
phan hydroxylase (TrH, 1:250), y-aminobutyric acid (GABA,
1:500), control mouse, rabbit, and rat IgGs, and FITC- and
Cy3-labeled secondary antibodies were from Sigma. Antibodies
against Nestin (1:150) and Nurrl (1:250, were from BD Trans-
duction Laboratories (Lexington, KY). Antibodies against glial
fibrillary acidic protein (GFAP, 1:400) were from DAKO or
Santa Cruz Biotechnology. Anti-dopamine antibodies (1:2,000)
were from Abcam (Cambridge, U.K.~. Polyclonal antibodies
against Tau (1:400) were from Santa Cruz Biotechnology, and
Cy5-labeled secondary antibodies were from Chemicon.
Electrophysiology. Standard whole-cell patch-clamp recording
methodologies were used to examine the physiological proper-
ties of cultured BM stem cells. Voltage-clamp and current-clamp
recordings were obtained by using a Dagan 3900A patch-clamp
amplifier (Dagan, Minneapolis), which was retrofitted with a
Dagan 3911 expander unit. Patch pipettes, made from borosili-
cate glass, were pulled on a Narishige pipette puller (model
PP-83~. The pipettes were filled with an intracellular saline that
consisted of 142.0 mM KF, 7.0 mM Na2SO4, 3.0 mM MgSO4, 1.0
mM CaCl2, 5.0 mM Hepes, 11.0 mM EGTA, 1.0 mM glutathione,
2.0 mM glucose, 1.0 mM ATP (magnesium salt), and 0.5 mM
GTP (sodium salt) (Sigma). For most recordings, the fluorescent
dye 5,6-carboxyfluorescein (0.5 mM, Eastman Kodak) was also
added to the pipette solution to visually confirm by using
fluorescence microscopy that the whole-cell patch-recording
configuration had been achieved. Pipette resistances ranged
from 11 to 24 MQ. The standard extracellular recording saline
was comprised of 155 mM NaCl, 5.0 mM KCl, 1.8 mM CaCl2, 1.0
mM MgCl2, 10 mM Hepes, and 5 mM glucose (Sigma). For some
experiments, 1 ,uM tetrodotoxin (TTX) was added to the
standard control solution. The pH of the intracellular and
extracellular recording solutions was adjusted to 7.4 and 7.8,
respectively. Unless otherwise noted, all chemical compounds
were obtained through Sigma. PCLAMP S.0 (Axon Instruments,
PNAS | September30, 2003 I vol. 100 I suppl. ~ 1 11855
OCR for page 40
Table 2. mRNA levels on days 5, 7, 10, and 14 of differentiation of mMAPCs to neuroectoderm
Day O Day 5 Day 7 Day 10 Day 14
Sox-1* 0 0.57; 1.79; 2.22 0.58; 1.15; 2.14 0.68; 0.59; 5.58 0.9; ND; 1.74
Otx-2* 0 0.11; 0.25; 3.4 0.21; 0.06; 4.2 0.12; 0.08; 2.4 ND; ND; 3.5
Otx-1* 0.01 0.33; 1.18; 7.06 0.36; 0.69; 32.1 0.26; 0.33; 24 1.67; ND; 5.31
Pax-2* 0 6.0; 8.2; 3.07 4.47; 7.06; 5.43 2.39; 1.64; 2.05 5.5; ND; 4.99
Pax-5* 0 0.11; 0.14; 0.9 0.13; 0.16; 3.75 0.05; 0.03; 1.84 0.48; ND; 1.33
En-1* 4.87 0.59; 1.45; 4.36 0.2; 0.8; 11.4 0.15; 0.32; 8 0.4; ND; 1.08
cRett 0.14 2.84; 5.46; 15.7 2.19; 5.08; 72.8 2.53; 4.47; 54.2 24,17; ND; 36.9
Nurr-1i 0 0.55; 2.4; 0.38 1.12; 1.47; 1.11 1.41; 3.59; 1.6 ND; ND; 1.68
Nestin* 0.52 27.3; 98.0; 50.4 10.2; 88.6; 70.8 5.9; 12.2; 243 6.48; ND; 14.7
GFAPi 0 0.56; 0.52; 1.05 0.36; 0.52; 3.26 1.32; 5.76; 21.0 11.75; ND; 9.19
MBPi 0 0.004; 0.006; 0.013 0.003; 0.008; 0.006 1.7; 4.08; 1.8 1.8; ND; 2.33
GABAt 0 1.36; 1.89; 6.23 0.99; 1.74; 17.5 7.8; 19.77; 94.0 61.8; ND; 69.6
DAM 0 1.58; 4.39; 19.9 0.5; 2.83; 22.71 1.81; 5.66; 119 13.4; ND; 23.67
THi 0 0.67; 1.31;-0.36 O.5; 1.2; 2.86 1.27; 3.94; 2.54 1.7; ND; 2.29
TrHt 0 0.49; 1.6; 0.46 0.51; 1.04; 4.99 1.56; 3.56; 7.14 3.92; ND; 3.81
DBH* 0 0 0 0 0
RNA was extracted from MAPCs, MAPCsdifferentiatedfor5,7,10, and 14 days, and brainfrom E18Oradultmice. Contaminating DNA
was eliminated by two sequential steps of DNAse treatment, mRNA was reverse-transcribed, and cDNA was amplified for 40 rounds of
amplification with SYBR green PCR master mix. Controls consisted of amplifications without reverse transcription and reactions without
addition of cDNA template. mRNA levels were normalized by using GAPDH as housekeeping gene and compared with levels in E 18 fetal
brain or adult mouse brain.
*Relative abundance in cultured cells compared with fetal brain.
Relative abundance in cultured cells compared with adult brain.
Foster City, CA) was used to run experiments and collect and
store data. The data presented herein were corrected for an
8.4-mV liquid junctional potential, which was calculated by using
the JPCALC software package (22J. Off-line analyses and graph-
ical representations of the data were constructed by using
CLAMPFIT 8.0 (Axon Instruments) and PRISM (GraphPad, San
Diego).
Results
Undifferentiated mMAPCs Did Not Have Neuroectodermal Character-
istics. No staining was seen with antibodies against nestin, GFAP,
NF-200, MBP, or neurotransmitters (data not shown). By quan-
titative RT-PCR, mMAPCs did express low levels of c-Ret,
Otx-2, and nestin mRNA but no mRNA for soxl, otx2, Pax2,
Pax5, Nurrl, GFAP, MBP, dopamine, TH, GABA, TrH, or
DBH (Table 2~.
Culture Conditions for Neuroectodermal Differentiation from MAPCs.
Because neuroprogenitors can be expanded with platelet-
derived growth factor (PDGF)-BB and induced to differentiate
by the removal of PDGF and addition of bFGF (23), we initially
replated undifferentiated MAPCs at 10,000 cells per cm2 on
fibronectin-coated plates or chamberslides, removed epidermal
growth factor, PDGF, and leukemia inhibitory factor, and added
100 ng/ml bFGF. Quantitative RT-PCR of mMAPCs treated
with bFGF for 5 and 7 days demonstrated acquisition of neu-
roectodermal transcripts. On days 5 and 7, mRNA for soxl, otx2,
otxl, pax2, pax5, and Nurrl could be detected at levels between
0.1- and 7-fold those seen in fetal brain (three independent
experiments) (Table 24. By days 5 and 7, nestin mRNA levels
increased to between 7- and 100-fold those in fetal brain (Table
2~. Immunohistochemistry showed that by day 5, cells started to
express nestin protein. By day 7, 65 + ll~o of cells stained
positive for nestin; 23 + 8% of nestin-positive cells also ex-
pressed Nurrl (a representative example is shown in Fig. 1; see
also Table 3~. By day 10, 62 + 7% of cells expressed NF-200, 15 +
5% GFAP, and 11 + 3% MBP (a representative example is
shown in Fig. 1), consistent with the finding that mRNA for
GFAP and MBP increased to 1- to 4-fold over that detected in
fetal brain. Double immunohistochemistry showed that GFAP,
11856 1 www.pnas.org/cgi/doi/ 10.1 073/pnas. 1834196100
MBP, and NF-200 were never detected in the same cells. When
cultures were maintained in the presence of bFGF alone, cells
started dying by days 10-14.
When mMAPCs were cultured sequentially with 100 ng/ml
bFGF for 7 days followed by a combination of 10 ng/ml FGF8
and 100 ng/ml SHH for 7 days and finally 10 ng/ml BDNF for
7 days, the latter in medium also supplemented with N2 medium,
a more mature phenotype was seen. Quantitative RT-PCR
demonstrated that by days 10 and 14, levels of GABA, dopamine,
and TH, and TrH mRNA increased between 1.7- and 120-fold.
Immunophenotypic analysis on day 21 showed that 25 + 7% of
cells expressed markers of dopaminergic neurons (shown are
DDC and TH; also dopamine), 18 + 3% expressed markers of
serotonergic (TrH) neurons, and 52 + 5% expressed markers of
GABA-ergic (GABA) neurons (a representative example is
shown in Fig. 1; see also Table 3~. Double immunohistochemistry
showed that GABA, TrH, and TH (or DCC or dopamine) were
never detected in the same cells. Neuron-like cells became
polarized, because Tau and microtubule-associated protein were
expressed in axonal and somatodendritic compartments, respec-
tively. Fewer than 10% of cells stained positive for astrocytes or
oligodendrocyte markers (data not shown). Consistent with this
immunohistology, levels of MBP and GFAP mRNA decreased
by day 21 (data not shown). A significant proportion of cells died
when maintained in BDNF for >7 days.
Based on studies by Wagner et al. (24) and Song et al. (25), we
next tested whether cultured neuron-like cells could be main-
tained in vitro for more extended periods of time to allow further
maturation when cultured in the presence of fetal brain astro-
cytes. Astrocytes were cultured from E16 fetal brain in 10% FCS.
After several passages, no neural cells could be detected by
immunofluorescence microscopy (data not shown). In initial
studies, astrocyte-conditioned medium was added to the devel-
oping neuroectodermal cells generated from MAPCs. However,
no significant further morphologic maturation was observed
(data not shown). In subsequent experiments, astrocytes were
plated onto coverslips and allowed to grow to confluence.
Coverslips were placed upside down in chamberslides in which
enhanced GFP (eGFP)-transduced MAPCs had been cultured
for 7 days with bFGF, 7 days with FGF8 plus SHH, and 7 days
Jiang eta/.
OCR for page 41
d7
dlO
d21
Fig. 1. mMAPCs were cultured sequentially for 7 days with 100 ng/ml bFGF,
10 ng/ml FGF8 and 100 ng/ml SHH, and 10 ng/ml BDNF on fibronectin-coated
chamberslides. After 7, 10, and 21 days, cells were fixed and stained with
antibodies against nestin and Nurr1 followed by secondary Cy5- and Cy3-
couoled antibodies, resoectivelv (d7); NF-200 and GFAP followed bv secondary
. . . . ..
Cy3- and Cy5-coupled antibodies, respectively (1) and NF-200 and MBP fol-
lowed by secondary Cy3- and Cy5-coupled antibodies, respectively (2) (d10);
and GABA and DDC followed by secondary Cy5- and Cy3-coupled antibodies,
.. . , ~ _ .. . .. . .. . .
respectively (1), TrH and TH followed by secondary Cy5- and Cy3-coupled
antibodies, respectively (2), and microtubule-associated protein and Tau fol-
lowed by secondary Cy3- and Cy5-coupled antibodies, respectively (3) (d21).
with BDNF in N2 medium. After an additional 5-12 days in
culture, eGFP-expressing MAPC-derived neuron-like cells again
were evaluated by immunofluorescence, and we demonstrated
that eGFP-positive cells continued to express markers of dopa-
minergic neurons (~25% TH and dopamine), serotonergic
neurons (~25% TrH), and GABA-ergic neurons (~50%
GABA) and acquired a much more mature neural morphology
with a more elaborate array of axons (a representative example
is shown in Fig. 2~.
MAPC-Derived Neuron-Like Cells Acquire Functional Voltage-Gated
Sodium Channels. Patch-clamp recordings were obtained from 50
MAPCs from five independent cultures. Recordings were made
from cells that were cultured for 7 days each with bFGF, FGF8b
and SHH, and BDNF followed by either coculture with astro-
cytes for 5 days (9 neuron-like cells were tested from a single
experiment), 7 days (9 neuron-like cells were tested from a sin~le
experiment), 8 days (14 neuron-like cells were tested from a
single experiment), 9 days (9 neuron-like cells were tested from
a single experiment), and 12 days (2 neuron-like cells were tested
from a single experiment) or cells that were incubated for 7 days
Jiang et a/.
Table 3. Percentage of cells expressing neuronal markers
during differentiation
Day 7 Day 10 Day 21
Day 30
Nestin 65 + 1 1
Nurr1
N F200
G FAP
MBP
DDC/TH/Dopa
TrH
GABA
23 + 8 NA
o
o
o
o
o
o
NA NA
NA
62 + 7 90 + 5
15+5 3+2
11 + 3 2 + 2
0 25+7
NA
NA
92 + 6
2 + 2
2 + 3
22 + 8
0 18 + 3 23 + 2
52 + 3
0 52 + 5
Cells were fixed with 4% paraformaldehyde (Sigma) for 4 min at room
temperature followed by methanol (Sigma) for 2 min at -20°C. For nuclear
ligands, cells were permeabilized with 0.1 M Triton X-100 (Sigma) for 10 min.
Slides were incubated sequentially for 30 min each with primary antibody and
FITC or Cy3- or Cy5-coupled anti-mouse-, goat-, or rabbit-lgG antibodies.
Between each step, slides were washed with PBS plus 1% BSA (Sigma). Cells
were examined by confocal fluorescence microscopy (confocal 1024 micro-
scope, Olympus AX70). To assess the frequency of different celI types i n a given
culture, we counted the number of cells staining positive with a given anti-
body in four visual fields (50-200 cells per field). Results shown are mean +
SEM from three independent differentiations from MAPCs to neuroectoder-
mal cells evaluated after 7-30 days.
with conditioned medium from cultures of fetal brain astrocytes
(7 neuron-like cells were tested from a single experiment). At all
time points, the resting membrane potentials (RMP) of cells
cocultured with astrocytes were variable, ranging between -8.4
and -55.4 mV. However, RMPs tended to become more neg-
ative as a function of time in culture with astrocytes. The median
RMPs were -27.4, -33.7, -41.9, and -44.4 mV after 5, 7, 8, and
9 days, respectively, in coculture. Input resistance also varied
considerably across cells (range = 0.133-9.8 GQ); however, no
trend was apparent in the value of input resistance as a function
of time the cells spent in culture with astrocytes (median input
resistance = 2.4, 1.6, 2.4, and 1.2 GQ after 5, 7, 8, and 9 days in
culture with astrocytes, respectively). Current-clamp recordings
demonstrated that spiking was observed in cells that were
cocultured with astrocytes at all time points examined. Fig. 3A
illustrates an example of spiking behavior evoked from a cell that
had been cocultured with astrocytes for 8 days. Interestingly, the
proportion of cells studied that were capable of generating action
potentials increased dramatically after day 5 in culture with
astrocytes. Twenty-two percent of cells that were cocultured with
astrocytes for only 5 days spiked. In contrast, after day 5, spiking
cells represented between 71% and 100% of cells studied at each
time period. Voltage-clamp experiments showed that spiking
MAPCs expressed a rapidly inactivating inward current. This
transient inward current generally could not be elicited from
cells, which failed to produce a spike in current-clamp experi-
ments (a small transient inward current was observed in only one
of the nonspiking MAPCs). Fig. 3B shows the inward sodium
current that was elicited from the same cells as in Fig. 3A.
Approximately 67% of spiking cells could be made to spike
repetitively in response to depolarizing current-injection steps;
the other 33% of cells generated only a single action potential
with varying amounts of depolarizing current stimulation. Where
examined, the spiking behavior and transient inward currents
were blocked by TTX (see Fig. 3 A and B, TTX). All cells
examined that were cocultured with astrocytes had outward
currents; however, the identities of those currents remain to be
determined. Voltage and current traces from our patch-clamp
recordings also suggested the occurrence of synaptic events (Fig.
3C, see arrows).
Spikes could not be elicited from cells that had been treated
with conditioned medium for 7 days. We also failed to observe
PNAS 1 September 30, 2003 1 vol. 100 1 suppl. 1 1 11857
OCR for page 42
A Current Camp Protocol: B Voltage Clamp Protocol:
.,
Fig. 2. eGFP-transduced mMAPCs (28% transduction efficiency) were cul-
tured on fibronectin-coated chamberslides sequentially for 7 days with 100
nq/ml bFGF, 10 nq/ml FGF8 and 100 nq/ml SHH, 10 ng/ml BDNF, and finally
_ . _ .
with E16 fetal mouse brain astrocytes plated on coverslips that were placed
upside down in the chamberslides. After a total of 28 days, cellswere fixed and
stained. Slides were analyzed for the presence of GFP-positive cells and cells
containing with Cy3- or Cy5-labeled antibodies. (A) Cells labeled with anti-
bodies against GABA and DDC. (A1-A3) Single fluorescence color analysis of
cells stained with antibodies against GABA followed by secondary Cy3-
coupled antibody, eGFP-labeled cells, and cells stained with antibodies against
DDC followed by secondary Cy5-coupled antibody, respectively. (A4-A6) Over-
lay pictures of GFP/anti-GABA-Cy3, anti-GABA Cy3/anti-DDC-Cy5, and GFP/
anti-DDC-Cy5, respectively. Shown is that GFP-positive cells acquired morpho-
logical and phenotypic features of GABA-ergic and dopaminergic neurons,
whereas a fraction of cells with morphological and phenotypic features of
GABA-ergic and dopaminergic neurons was GFP-negative. (B) Cells labeled
with antibodies against TrH and dopamine. (B1-B3) Single fluorescence color
analysis of cells stained with antibodies against TrH followed by secondary
Cy3-coupled antibody, eGFP-labeled cells, and cells stained with antibodies
against dopamine followed by secondary Cy5-coupled antibody, respectively.
(B4-B6) Overlay pictures of GFP/anti-TrH-Cy3, anti-TrH-Cy3/anti-dopamine-
Cy5, and GFP/anti-dopamine-Cy5, respectively. Shown is that GFP-positive
cells acquired morphological and phenotypic features of serotonergic and
dopaminergic neurons, whereas a fraction of cells with morphological and
phenotypic features of serotonergic and dopaminergic neurons was GFP-
negative.
sodium currents from cells in this treatment condition. Median
resting membrane potential and input resistance were - 20.9 mV
and 2.25 GQ, respectively. However, similar to cells that were
cocultured with astrocytes, most cells (6/7 cells) had outward
currents.
Discussion
We demonstrate here that stem cells obtained from BM can be
induced to differentiate into cells with morphological and phe-
notypical characteristics of central nervous system neurons.
Differentiation of marrow pluripotent stem cells to neuron-like
cells follows similar developmental steps as described for ES cells
and NSCs. Similar to neurons derived from NSCs or ES cells in
vitro, in vitro-differentiated MAPCs also exhibit electrophysio-
logical characteristics of neurons.
11858 1 www.pnas.org/cgi/doi/10. 1 073/pnas.18341 96100
2n mV
Control
4~ ~v .
500 ms ) \
-100 mV ~ ~ ..... . ... \.
___—
Recovery
-100 mV ~
C current Clamp Protocol:
c~ ,
~-
500 nK
Control
TTX
Recove~y
!~V ~
LN
Sms
Fig. 3. Spiking behavior and voltage-gated currents from MAPCs in cocul-
ture with fetal mouse brain astrocytes. (A) Current-clamp recordings from a
MAPC that had been cocultured with astrocytes for 8 days. Illustrated in the
bottom three panels are the voltage responses elicited by the current-
injection protocol shown (a 1 7-pA current-injection step, Top). The repetitive
spiking recorded in this cell was blocked reversibly by TTX. The current-
injection protocol reports the current injected relative to a negative DC
current that was injected into the cell to "hold" it near -100 to -130 mV. (B)
Voltage-clamp recordings of leak-subtracted currents from the same cell
shown in A. (Top) The voltage-clamp protocol used to elicit the families of
currents shown in the bottom three panels. A large transient inward current
was evident that could be blocked reversibly by TTX. (C) Current-clamp records
obtained from a MAPC that had been in culture with astrocytes for 8 days. In
this example, the cell produced only one spike in response to depolarizing
current injections (A pA = 7). The arrows point to possible synaptic potentials.
A large body of work exists in which differentiation of adult
or fetal NSCs and mES cells to neurons, and specifically dopa-
minergic neurons, has been evaluated ex vivo and during em-
bryonal life. The soxl homeobox gene is expressed early and
exclusively during neuroectoderm commitment. The Otx ho-
meobox genes (0~1 and Otx2) are widely expressed at early
stages of neuroectoderm differentiation (26~. Otx2 is expressed
throughout the epiblast and subsequently restricted to the
anterior neuroectoderm, where it is required for development of
the forebrain and midbrain. Otxl is first expressed in the dorsal
telencephalon, and interactions between Otxl and Otx2 are
thought to specify the development of the midbrain. NSCs can
be defined by the presence of the intermediate filament protein
nestin (27, 28), which is also found in young neurons, reactive
glial cells, and ependymal cells (294. Neuroprogenitors then
acquire specific neurotransmitter fates through the action of
cytokines. For instance, differentiation of dopaminergic and
serotoninergic neurons in the midbrain and hindbrain is con-
,
~iang et a/.
OCR for page 43
trolled by SHH and FGF8b, which leads to the selective activa-
tion of the transcription factor Nurrl (30-324. In addition,
differentiation requires activation of several other transcription
factors including Pax2 and Pax5 (24, 33-364. Lee et al. (37)
showed that generation of neuroprogenitors, and subsequently
dopaminergic neurons from mES cells, occurs through sequen-
tial activation of these same transcription factors in response to
the same external stimuli as have been identified for embryonal
development and in vitro differentiation of NSCs.
Fetal- or adult brain-derived NSCs and neuroprogenitors are
expanded with the mitogens epidermal growth factor and bFGF,
and differentiation to neurons and glial cells occurs when bFGF or
epidermal growth factor is withdrawn (38-404. Other studies have
used PDGF to expand neuroprogenitors and induced differentia-
tion by the removal of PDGF and addition of bFGF (23~. Rodent
or human neuroprogenitors can also be expanded with epidermal
growth factor alone, while undergoing initial -differentiation to
astrocytes and oligodendrocytes but less neuronal cells, or bFGF
alone, while undergoing initial differentiation to neurons and to a
lesser extent glia (41~. We demonstrate here that differentiation of
mMAPCs to cells with neuroectodermal characteristics occurs by
initial culture in the presence of bFGF as the sole cytokine, and that
this is associated with the activation of transcription factors known
to be important in neural commitment in viva and differentiation
from NSCs and mES cells in vitro. However, differentiation to
mature neuron-like cells was not seen when bFGF was used as the
sole differentiation agent.
After sequential stimulation with bFGF, FGF8b and SHH,
and BDNF (42), a neurotrophin known to support survival of
dopaminergic neurons in vitro and in vivo (43, 44), development
of cells with a neuroectodermal morphology and staining pattern
could be seen. Such neuron-like cells became polarized. As has
been described in most studies in which ES cells or NSCs were
differentiated in vitro to a midbrain neuroectodermal fate,
~25~ of cells stained positive for dopaminergic markers, 25~o
for serotonergic markers, and 50~o for GABA-ergic markers (24,
25, 37, 45-474. Despite the addition of BDNF, neuron-like cells
could not be maintained beyond 21 days in culture. Neuron-like
cells expressed glutamate as well as glutamate receptors (data
not shown). Because few if any astrocytes (which bind and
remove glutamate) could be detected in these cultures, we
speculate that cell death may be caused by glutamate toxicity.
A number of studies have found that terminal neuronal differ-
entiation requires yet-to-be-characterized factors secreted by
region-specific glial cells. For instance, Wagner et al. (24) found that
coculture of Nurrl neurons with type II astrocytes from primary
E16 rat ventral mesencephalon, the age and region where endog-
enous neurons of the substantia nigra have just been born, yielded
a significant numbers of functioning dopaminergic neurons. Pan-
chision et al. (48) created a type II astrocyte line that supports
terminal differentiation of dopaminergic neurons. Song et al. (25)
demonstrated that neural differentiation in vitro occurred when
NSCs were cocultured with brain-derived astrocytes, and that the
type of neuron generated was dictated by the brain-specific region
from which astrocytes were derived. We tested whether the addition
1. Ferrari, G., Cusella-De Angelis, G., Coletta, M., Paolucci, E., Stornaiuolo, A.,
Cossu, G. & Mavilio, F. (1998) Science 279, 528-530.
2. Gussoni, E., Soneoka, Y., Strickland, C., Buzney, E., Khan, M., Flint,
Kunkel, L. & Mulligan, R. (1999) Nature 401, 390-394.
3. Rafii, S., Shapiro, F., Rimarachin, J., Nachman, R., Ferris, B., Weksler, B.,
Moore. M. & Asch. A. (1994) Blood 84. 10-19.
7 _ _ ,
4. Asahara, T., Murohara, T., Sullivan, A., Silver, M., van der Zee, R., Li, T.,
Witzenbichler, B., Schatteman, G. & Isner, J. (1997) Science 275, 964-967.
5. Lin, Y., Weisdorf, D. J., Solovey, A. & Hebbel, R. P. (2000) J. Clin. Invest. 105,
71-77.
6. Orlic, D., Kajstura, J., Chimenti, S., Jakoniuk, I., Anderson, S. M., Li, B., Pickel,
J., McKay, R., Nadal-Ginard, B., Bodine, D. M., et al. (2001) Nature 410,
701-705.
Jiang et a/.
of astrocyte-conditioned medium or astrocytes themselves would
induce further maturation and prolonged survival of the mMAPC-
derived neuron-like cells. Astrocytes were obtained from whole
fetal brain at E16. The addition of astrocyte-conditioned medium
did not affect the survival or maturation of mMAPC-derived
neuron-like cells significantly. However, coculture with fetal brain
astrocytes resulted in prolonged survival and further morphological
maturation of the neuron-like cells. These findings are consistent
with the findings from Wagner et al. (24) and may suggest that the
effects exerted by astrocytes may be as simple as the removal of
glutamate from the culture, as discussed earlier, leading to pro-
longed survival of neuronal cells and allowing further maturation.
Alternatively, a direct cell-cell interaction event may be needed, or
factors responsible for the neuronal maturation are unstable and
therefore only present in low concentrations when astrocyte-
conditioned medium is used rather than astrocytes themselves.
Aside from further morphological maturation observed after
coculture of neuron-like cells with fetal brain astrocytes, we also
observed acquisition of electrophysiological characteristics con-
sistent with neurons. Occurrence of spiking behavior that can be
attributed to voltage-gated sodium channels was found in 22%
of cell cocultured for 5 days with fetal brain astrocytes and
between 80% and 100% of cells cocultured with astrocytes for
7-12 days but not in cells exposed to astrocyte-conditioned
medium. Currerlt traces from our patch-clamp recordings also
suggested the occurrence of synaptic events.
The mechanism underlying the finding that cells from BM can
differentiate into neuron- and glia-like cells remains unknown.
Several possible explanations have been suggested, including the
possibility that multiple stem cells exist in postnatal tissues (17, 49~.
However, we have shown previously that single MAPCs differen-
tiate in vitro and in vivo in multiple differentiated cells from
mesoderm, endoderm, and ectoderm (20~. A second possibility is
that cells of one type (BM cells, for example) fuse with a second cell
type, and the fused cell, which is mostly hyperdiploid, acquires the
characteristics of the second cell type (50, 51~. However, we show
here that neuronal characteristics are acquired without coculture
with brain-derived cells even though full maturation to neurons
with electrophysiological characteristics requires coculture with
fetal brain astrocytes. Whether dedifferentiation or reprogramming
of a mesenchymal stem cell to a more pluripotent cell capable of
differentiating to cells outside the mesoderm or whether a more
pluripotent stem cell persists even after birth are questions that are
unanswered at this time.
In conclusion, we demonstrate here that BM-derived MAPCs
can be induced to differentiate to cells with biochemical, mor-
phological, and electrophysiological characteristics of midbrain
dopaminergic, serotonergic, and GABA-ergic neurons. If future
studies demonstrate that such cells can engraft in vivo, they may
be an excellent source of cells for treatment of neurodegenera-
tive disorders.
This work was supported by National Institutes of Health Grants
RO1-DK061847 and RO1-DK-58295, the Michael J. Fox Foundation,
the Tulloch Family, and the McKnight Foundation.
7. Jackson, K., Majka, S. M., Wang, H., Pocius, J., Hartley, C., Majesky, M. W.,
Entman, M. L., Michael, L., Hirschi, K. K. & Goodell, M. A. (2001) J. Clin.
Invest. 107, 1395-1402.
8. Petersen, B. E., Bowen, W. C., Patrene, K. D., Mars, W. M., Sullivan, A. K.,
Murase, N., Boggs, S. S., Greenberger, J. S. & Goff, J. P. (1999) Science 284,
1168-1170.
9. Theise, N. D., Badve, S., Saxena, R., Henegariu, O., Sell, S., Crawford, J. M.
& Krause, D. S. (2000) Hepatology 31, 235-240.
10. Lagasse, E., Connors, H., Al-Dhalimy, M., Reitsma, M., Dohse, M., Osborne,
L., Wang, X., Finegold, M., Weissman, I. L. & Grompe, M. (2000) Nat. Med.
6, 1229-1234.
11. Krause, D. S., Theise, N. D., Collector, M. I., Henegariu, O., Hwang, S.,
Gardner, R., Neutzel, S. & Sharkis, S. I. (2001) Cell 105, 369-377.
PNAS | September30, 2003 | vol. 100 | suppl. ~ | 11859
OCR for page 44
12. Mezey, E., Chandross, K. J., Harta, G., Maki, R. A. & McKercher, S. R. (2000)
Science 290, 1779-1782.
13. Brazelton, T. R., Rossi, F. M. V., Keshet, G. I. & Blau, H. E. (2000) Science
290, 1775-1779.
14. Bjornson, C., Rietze, R., Reynolds, B., Magli, M. & Vescovi, A. (1999) Science
283, 354-357
15. Shih, C. C., Weng, Y., Mamelak, A., LeBon, T., Hu, M. C. & Forman, S. (2001)
Blood 98, 2412-2422.
16. Jackson, K., Mi, T. & Goodell, M. A. (1999) P'oc. Natl. Acad. Sci. USA 96,
14482-14486.
17. Kawada, H. & Ogawa, M. (2001) Blood 98, 2008-2013.
18. Schwartz, R. E., Reyes, M., Koodie, L., Jiang, Y., Blackstad, M., Johnson, S.,
Lund, T., Lenvik, T., Hu, W.-S. & Verfaillie, C. M. (2002) J. Clin. Invest. 96,
1291-1302.
19. Jiang, Y., Vaessen, B., Lenvik, T., Blackstad, M., Reyes, M. & Verfaillie, C. M.
(2002) Exp. Hematol. (Charlottesville, Pa) 30, 896-904.
Jiang, Y., Jahagirdar, B., Reyes, M., Reinhardt, R. L., Schwartz, R. E., Chang,
H.-C., Lenvik, T., Lund, T., Blackstad, M., Du, J., et al. (2002) Nature 418,
41-49.
21. Keene, C. D., Ortiz-Gonzalez, X. R., Jiang, Y., Largaespada, D. A., Verfaillie,
C. M. & Low, W. C. (2003) Cell Tran~plant. 12, 201-213.
22. Barry, P. H. (1994)J. Ner~rosci. Method~ 51, 107-116.
23. Palmer, T. D., Markakis, E. A., Willhoite, A. R., Safar, F. & Gage, F. H. (1999)
J. Ner~rosci. 19, 8487-8497.
24. Wagner, J., Akerud, P., Castro, D. S., Holm, P. C., Canals, J. M., Snyder, E. Y.,
Perlmann, T. & Arenas, E. (1999) Nat. Biotechnol. 17, 653-659.
Song, H., Stevens, C. F. & Gage, F. H. (2002) Nature 417, 39-44.
25.
26. Simeone, A. (1998) EMBO J. 17, 6790-6798.
27. Lendahl, U., Zimmerman, L. B. & McKay, R. D. (1990) Cell 60, 585-595.
28. Cattaneo, E. & McKay, R. (1990) Nat~re 347, 762-765.
29. Johansson, C. B., Momma, S., Clarke, D. L., Risling, M., Lendahl, U. & Friser
J. (1999) Cell 96, 25-34.
~' ' ' V ' \ J
30. Cazorla, P., Smidt, M. P., O'Malley, K. L. & Burbach, J. P. (2000) J. Neurochem.
74, 1829-1837.
31. Smidt. M. P. van Schaic~ H. S Lanctot. C Tremblav. J. J C`'x. J J an der 50.
51.
Kleij, A., Wolterink, G., Drouin, J. & Burbach, J. P. (1997) Proc. Natl. A cad.
Sci. USA 94, 13305-13310.
32. Perrone-Capano, C. & Di Porzio, U. (2000) I'~t. J. Dev. Biol. 44, 679-687.
11860 1 www.pnas.org/cgi/doi/10. 1 073/pnas.1 834196100
33. Stoykova, A. & Gruss, P. (1994) J. Neurosci. 14, 1395-1412.
34. Rowitch, D. H. & McMahon, A. P. (1995) Mech. Dev. 52, 3-8.
35. Danielian, P. S. & McMahon, A. P. (1996) Nature 383, 332-334.
36. Saucedo-Cardenas, O., Quintana-Hau, J. D., Le. W. D., Smidt, M. P., Cox, J. J.,
De Mayo, F., Burbach, J. P. & Conneely, O. M. (1998) Proc. Natl. Acad. Sci.
USA95,4013-4018.
37. Lee, S. H., Lumelsky, N., Studer, L., Auerbach, J. M. & McKay, R. D. (2000)
Nat. Biotechnol. 18, 675-679.
38. Richards, L. J., Kilpatrick, T. J. & Bartlett, P. F. (1992) Proc. Natl. Acad. Sci.
USA 89, 8591-8595.
J ~ ~ 7 ~ ~ ~ 7 ~ ' \ ~ J ~ — 7 ~
40. Gritti, A., Frolichsthal-Schoeller, P., Galli, R., Parati, E., Cova, L., Pagano, S.,
Bjornson, C. & Vescovi, A. (1999) J. Neurosci. 19, 3287-3297.
41. Whittemore, S. R., Morassutti, D. J., Walters, W. M., Liu, R. H. & Magnuson,
D. S. (1999) Exp. Cell Res. 252, 75-95.
42. Hyman, C., Hofer, M., Barde, Y., Juhasz, M., Yancopoulos, G., Squinto, S. &
Lindsay, R. (1991) Nature 350, 230-232.
43. Alonso-Vanegas, M. A., Fawcett, J. P., Causing, C. G., Miller, F. D. & Sadikot,
A. F. (1999) J. Comp. Neurol. 13, 449-462.
44. Batchelor, P. E., Liberatore, G. T., Porritt, M. J., Donnan, G. A. & Howells,
D. W. (2000) E~r. J. Neurosci. 12, 3462-3468.
. Studer, L., Spenger, C., Seiler, R., Othherg, A., Lindvall, O. & Odin, P. (1996)
Exp. B'ain Res. 108, 328-336.
46. Kawasaki, H., Mizuseki, K., Nishikawa, S., Kaneko, S., Kuwana, Y., Nakanishi,
S., Nishikawa, S. I. & Sasai, Y. (2000) Neu~o'' 28, 31-40.
47. Kim, J. H., Auerbach, J. M., Rodriguez-Gomez, J. A., Velasco, I., Gavin, D.,
Lumelsky, N., Lee, S. H., Nguyen, J., Sanchez-Pernaute, R., Bankiewicz, K. &
McKay, R. (2002) Nat7ure 418, 50-56.
48. Panchision, D. M., Martin-DeLeon, P. A., Takeshima, T., Johnston, J. M.,
Shimoda, K., Tsoulfas, P., McKay, R. D. & Commissiong, J. W. (1999) J. Mol.
Neurosci. 11, 209-221.
49. McKinney-Freeman, S. L., Jackson, K. A., Camargo, F. D., Ferrari, G., Mavilio,
F. & Goodell, M. A. (2002) P'oc. Natl. Acad. Sci. USA 99, 1341-1346.
Ying, Q. Y., Nichols, J., Evans, E. P. & Smith, A. G. (2002) Nature 416, 545-548.
. Terada, N., Hamazaki, T., Oka, M., Hoki, M., Mastalerz, D. M., Nakano, Y.,
Meyer, E. M., More, L. l., Petersen, B. E. & Scott, E. W. (2002) Natll~e 416,
542-545.
Vescovi. A.. Revnolds. B.. Fraser. D. & Weiss S (l 993'' N`~ron 11 951-9f.f.
Jiang et al.
Representative terms from entire chapter:
stem cells
