|
Items in cart [1] |
Questions? Call 888-624-8373 |
| Copyright © 2009. National Academy of Sciences. All rights reserved. Terms of Use and Privacy Statement |
Below are the first 10 and last 10 pages of uncorrected machine-read text (when available) of this chapter, followed by the top 30 algorithmically extracted key phrases from the chapter as a whole.
Intended to provide our own search engines and external engines with highly rich, chapter-representative searchable text on the opening pages of each chapter.
Because it is UNCORRECTED material, please consider the following text as a useful but insufficient proxy for the authoritative book pages.
Do not use for reproduction, copying, pasting, or reading; exclusively for search engines.
OCR for page 50
Colloquium
Genetic and functional differences between
mu lti potent neura l and pluri potent
embryonic stem cells
Kevin A. D'Amour and Fred H. Gage*
Laboratory of Genetics, The Salk Institute for Biological Studies, 10010 North Torrey Pines Road, La Jolla, CA 92037
Stem cells (SCs) are functionally defined by their abilities to
self-renew and generate differentiated cells. Although much effort
has been focused on defining the common characteristics among
various types of SCs, the genetic and functional differences be-
tween multipotent and pluripotent SCs have garnered less atten-
tion. We report a direct genetic and functional comparison of
molecularly defined and clonally related populations of neural SCs
(NSCs) and embryonic SCs (ESCs), using the Sox2 promoter for
isolation of purified populations by fluorescence-activated cell
sorting. A stringent expression profile comparison of promoter-
defined NSCs and ESCs revealed a striking dissimilarity, and sub-
sequent chimera analyses confirmed the fundamental differences
in cellular potency between these populations. This direct com-
parison elucidates the molecular basis for the functional differ-
ences i n pluri potent ESCs and mu lti potent NSCs.
Stem cells (SCs) have become the topic of intense investigation
as model systems for understanding development and as po-
tential therapeutic agents (14. However, the relationship between
pluripotent and multipotent classes of SCs is uncertain, and the
possibility for cellular interconversion or investigator confusion
among these cells is a pressing issue in SC biology. Most recently,
some observations of what appears to be exceedingly broad cell fate
potential have obscured rather than enlightened our current un-
derstanding of development (reviewed in ref. 24. These results have
been controversial (3-6), and the development of techniques for
identifying and isolating SCs is a paramount objective for further
characterization of this phenomenon (7~.
Because methods for isolating SCs are varied and not well
developed, we sought an approach that would allow the isolation
of both embryonic SCs (ESCs) and neural SCs (NSCs) to
investigate the genetic and functional relationships between
these SC classes. The transcription factor Sox2 has several ideal
properties for use in comparing ESCs and NSCs. First, Sox2 is
strongly associated with the pluripotent phenotype, because it is
expressed in ESCs and gene-deleted mice exhibit embryonic
lethality at implantation (8, 9~. Furthermore, Sox2 is known to
act cooperatively at several promoters with Oct4 (10-13), and
Oct4 is believed to be the master regulator of the pluripotent
state (14, 15~. Second, outside of these pluripotent cells, Sox2 is
a neural restricted gene (16) and therefore unequivocally iden-
tifies a neural tissue of origin. This property is useful for further
characterizing the phenomenon of unexpected plasticity in NSC
populations (7~. Third, a Sox2 regulatory element has been
described that expresses in ESCs as well as in neural progenitor
populations (17~.
Materials and Methods
Production of Transgenic Mice and Isolation of Cells. The Sox2
promoter fragment used in these studies consists of the 5.5-kb
BglII fragment immediately 5' to the Sox2 gene. A pBluescript
11866-11872 1 PNAS 1 September 30, 2003 1 vol. 100 1 suppl. 1
KS + clone of this region was the kind gift of Angie Rizzino (18).
Details regarding construction of the P/Sox2-GFP-Ires-Puro
vector are available on request.
Transgenic ESC clones were derived from ROSA26-4 (19,
ESCs as described (20) and were microinjected into blastocysts
to verify ESC clones that exhibited telencephalic-restricted
enhanced GFP (EGFP) expression.
Chimeric fetuses were generated via blastocyst injection of
P/Sox2-GIP ESCs, collected at embryonic day (E) 14, and exam-
ined by epifluorescent microscopy to select fetuses exhibiting high
degrees of chimerism (~75%~. The telencephalon was dissected
free of the meninges and remaining brain tissue, diced with a scalpel
blade, and digested for 5 min at 37°C in 1 ml of 0.25~o wt/vol
trypsin/0.54 mM EDTA. Then, 3 ml of ovomucoid trypsin inhibitor
(Sigma) at 0.7 mg/ml in DMEM/F12 (1:1) was added, and the
tissue was partly dissociated by trituration with a fire-polished
Pasteur pipette. The suspension was pelleted for 2 min at 500 x g.
The cell pellet was resuspended and further dissociated with a
fire-polished Pasteur pipette in PBS. The suspension was then
filtered through a 35 ~M cell strainer (Falcon) into a tube con-
taining 0.001% vol/vol DNase I and 5 1lg/ml propidium iodide for
analysis by fluorescence-activated cell sorting (FACS).
Flow Cytometry. Sorting and analysis of fluorescent cells were
performed on a FACStar Plus cell sorter equipped with an argon
laser (488 nm, 100 mW) and using CEL~QUEST software (BD
Biosciences). Cells were gated on forward and side scatter and
dead cells were excluded by eliminating propidium iodide-
positive events. Immediately after sorting, cells were pelleted for
3 min at 500 x g and resuspended in 200 ,ul of medium, and the
density of viable cells was determined by using a hemocytometer.
For isolation of total RNA, cells were sorted directly into
RNeasy lysis buffer (Qiagen, Valencia, CA) at 4°C to preserve
the integrity of the RNA. Cells were homogenized by passing
lysate over a QIAshredder column (Qiagen), and total RNA was
prepared according to the manufacturer's protocol.
Real-Time Quantitative PCR (Q-PCR). P/Sox2-EGFP-positive cells
were isolated by using FACS from neural stem/progenitor
cultures derived from E14 chimeric fetuses after 5 days in vitro
(DIV). Gates were set to collect nonoverlapping populations of
negative, low, and high P/Sox2-EGFP fluorescence intensity.
This paper results from the Arthur M. Sackler Colioquium of the Nationai Acaclemy of
Sciences, "Regenerative Meclicine," heicl October 18-22, 2002, at the Arnoic] anc] Mabei
Beckman Center of the Nationai Acaclemies of Science anc] Engineering in irvine, CA.
Abbreviations: SC, stem ceil; EGFP, enhanced GFP; En, embryonic clay n; ESC, embryonic SC;
FACS, fluorescence-activated ceil sorting; ICM, inner ceil mass; NSC, neural stem ceil; NSCc,
cuiturec] NSC; NSCf, freshly isoiatec] NSC.
*To whom corresponc~ence shouicl be acdcdressecl. E-maii: gage~saik.ec~u.
2003 by The Nationai Acaclemy of Sciences of the USA
www.pnas.org/cgi/doi/10.1 073/pnas. ~ 834200100
OCR for page 51
Real-time quantitation was carried out as described (21~. The
Sox2 primer sequences were forward 5' CACAGATGCAAC-
CGATGCA and reverse 5' GGTGCCCTGCTGCGAGTA.
Immunostaining. Immunocytochemical analysis was performed as
described (22~.
Cell Culture. ESCs were cultured by using standard procedures.
Neural stem/progenitor cells were cultured on untreated tissue
culture plastic in serum-free media composed of DMEM/F12
(1:1) containing N2 or B27 serum supplements (GIBCO) and 2
mM ~-glutamine. Mitogenic stimulation was in the presence of
human recombinant EGF and FGF2 (20 ng/ml each; Pepro-
Tech, Rocky Hill, NJ) and heparin (5 ,ug/ml). Differentiation
was carried out by plating 1 x 105 cells per cm2 on glass chamber
slides coated with laminin and poly-ornithine. Differentiation
media consisted of N2 supplemented with 0.5% FBS and 1 ,uM
forskolin. Media were changed every other day, and differenti-
ation proceeded for 6-8 days.
Qualitative RT-PCR Confirmation. Total RNA was isolated from
P/Sox2-EGFP-expressing ESCs and NSCs as described for ex-
pression profiling. Next, 4.0 ,ug of total RNA for each cell-type
was DNase-treated I:DNA-free, Ambion, Austin, TX) and di-
vided in half for first-strand cDNA synthesis with or without
reverse transcriptase by using the SuperScript II kit (Invitrogen).
One-twentieth of the cDNA reaction was taken for PCR tem-
plate and amplified for the following number of cycles: Oct4, 23
cycles ESC and 30 cycles NSC; Klf2, 40 cycles ESC and NSC;
NrObl, 23 cycles ESC and 30 cycles NSC; KlfS, 40 cycles ESC and
NSC; Crtrl, 40 cycles ESC and NSC; Klf4, 30 cycles ESC and
NSC; Pem, 30 cycles ESC and NSC; Rex2, 23 cycles ESC and 30
cycles NSC; Foxgl, 30 cycles NSC and ESC; Nr2fl, 40 cycles NSC
and ESC; Zicl, 40 cycles NSC and ESC; Mytl, 23 cycles NSC and
30 cycles ESC. Gapdh and p-actin were amplified for 23 cycles in
both NSC and ESC samples. The following primer sets were used:
Oct4, forward 5'-GTGTTCAGCCAGACCACCAT and reverse
5'-GAACCATACTCGAACCACATCC; Klf2, forward 5'-
CCCAGGAAAGAAGACAGGAG and reverse 5'-AAAAC-
GAAGCAGGCGGCAGA; NrObl, forward 5'-TAGATG-
Expression Profiling. P/Sox2-EGFP-positive cells were isolated GAGAAAGCGGTCGTAG and reverse 5'-GCGGGGT-
by using FACS from ESC cultures, E14 chimeric fetuses, or neural TAATGGAAAGAGATG; KlfS, forward 5 '-ATCTGAAA-
stem/progenitor cultures derived from E14 chimeric fetuses. Trip- CACGCGCGCACCAC and reverse 5'-GTCTACCACTGAG-
licate samples (5 ~g total RNA) were processed for labeling, GCACTGT; Crtrl,forwardS'-CCTATCTCTTCCTGCTGGGT
hybridization, and scanning as described (23), using Murine- and reverse 5'-GCACAGAGCCCACATACAGA; Klf4, forward
U74Av2 high-density oligo arrays (Affymetrix, Santa Clara, CA). 5'-ACAAAATGCCAAGGGGTGACTG and reverse 5'-
Initial quality control data analysis was performed with ref- CCAAGCACCATCATTTAGGCTG; Pem, forward 5'-CGTG-
erence to Sandberg et al. (24~' and determinations of differen- GACAAGAGGAAGCACAA and reverse 5'-TCTTCTCCT-
tially expressed genes were made by performing gene expression TCGCCTTCTGTTC; Rex2, forward 5'-CACAGAAGA-
comparisons between each of the three P/Sox2-defined SC AAGCAGGATCGC and reverse 5'-CCTCAGTCTCG-
populations with three different analysis methods. Empirical GGGCTAATC; Foxgl, forward 5'-CCTCCCCATTTCTG-
[MICROARRAY SUITE 4.0 (Affymetrix) and BULLFROG queries] TACGTTTG and reverse 5'-GTCCACCAGATAGCTC-
(24), statistical (Felix Naef algorithms) (25), and model-based CATGA; Nr2fl, forward 5'-AAGAACGATTTGGAAGAG-
(DCHIP I.0) (26) analysis methods were used. These methods tend GACC and reverse 5'-TGAAGAACAGCCTCGACAACAT;
to complement each other because they each rely on different Zicl, forward 5'-(51AAAACAGAGGAGGUAGUAAG and
sets of assumptions. Using multiple methods generates a list of reverse 5'-AAAGACCACCACGCCACGAT; Mytl, forward 5'-
differentially expressed genes of extremely high confidence CAGTGTCTCCTATGATGTCCTC and reverse 5'-GGCTG-
because of the requirement that the gene be detected as differ- CAAACTCCAAAACTTCC; Gapdh, forward 5'-ACCA-
ential by multiple, independent data analysis methods. A de- CAGTCCATGCCATCAC and reverse 5'-TCCACCACC-
tailed description of all of the data analysis procedures is CTGTTGCTGGA; p-actin, forward 5'-TCTTGTGGCTTTAG-
provided in Supporting Text, which is published as supporting GAGCTTGAC and reverse 5'-CCAGAGGCATACAGGGA-
information on the PNAS web site, www.pnas.org. CAAC.
Chimera Production Assay. P/Sox2-EGFP-positive cells were iso-
lated from E14 telencephalon or cultured neural stem/
progenitor cells by using FACS and were grown overnight in B27
media with growth factors. Cells were found primarily as single
cells or doublets the next day, and ~12 were injected into each
blastocyst. Blastocysts were allowed to reexpand for 2-4 h at
37°C, at which time they were examined by using an inverted
fluorescence microscope to assess the number of blastocysts that
had cells attached to the inner cell mass (ICM). Blastocysts were
transferred into the uterine horns of pseudopregnant females.
Embryos were collected at E9.5 and analyzed for EGFP expres-
sion by using an inverted fluorescence microscope. To detect
nontelencephalic chimerism, embryos were fixed for 10 min at
room temperature in 0.2% glutaraldehyde, washed three times
in detergent rinse, and then stained in 5-bromo-4-chloro-3-
indolyl ,8-D-galactoside (X-Gal) reaction solution overnight at
4°C (204. P/Sox2-GIP ESCs were used as a positive control for
ICM adherence and chimeric contribution.
For morula aggregation, the FACS-isolated cells were allowed
to proliferate for 2-3 DIV, at which time small neurospheres
(8-12 cells) were cocultured in microwells with morula-stage
embryos as described (274. After 24 h, the resulting blastocysts
were examined by fluorescence microscopy to determine
whether P/Sox2-EGFP-expressing cells had become incorpo-
rated into the ICM.
D'Amour ancl Gage
Results
P/Sox2-EGFP Permits Isolation of NSCs from Fetal Mice. We have
used the Sox2 promoter to express the EGFP (Fig. L4) in ESCs
and chimeric fetal mice to isolate genetically identical popula-
tions of ESCs and NSCs for direct genetic and functional
comparison. The transgene exhibits regional specificity to the
fetal telencephalon (Fig. 1B) and is exclusively expressed in the
immature neuroepithelium, as demonstrated by the lack of
EGFP colocalization with the early neuronal marker ,BIII-
tubulin (Fig. 1C). P/Sox2-EGFP-expressing cells were isolated
from the telencephalon of E14 chimeric fetal mice by using
FACS. The P/Sox2-expressing population was purified in this
manner before initiating cultures to eliminate cells that do not
express the transgene, because of regional specificity. This
purification step also eliminates nontransgenic cells derived
from the host blastocyst in these chimeric animals. From cul-
tured populations the proportion of P/Sox2-EGFP+ cells was
~8% (gate M4), and the population of EGFP+ cells was further
subdivided into high (M3) and low (M2) expression levels based
on fluorescence intensity (Fig. 1D). These positive populations,
as well as a population of P/Sox2-EGFP- cells, were individually
collected, and the levels of Sox2 mRNA were determined for
each by using real-time quantitative PCR. The fluorescence
intensity of P/Sox2-EGFP exhibits a positive correlation with the
amount of Sox2 mRNA (Fig. 1E). However, a significant level of
PNAS | September 30, 2003 | vof. 100 | suppl. ~ | 11867
OCR for page 52
A
(-5262)
1 5.5kb Sox2 promoter
P/Sox2-GIP
F
0 M1
E~ I ~
~ _
_ ~
_ M4
M2 M3
~ 0 __
1 00 104 1o2 103
P/Sox2-EGFP fluorescence
50-
=
O 40-
o
id 30
~ 20-
Q
~ 10-
4,
Z O -
40.sT
. ~ ' , ~
GFP(-) GFP(~)
: 2
M1 M2 Ma
P/Sox2-EGFP fluorescence
Fig. 1. P/Sox2-EGFP identifies a subset of Sox2-expressing cells that are NSCs.
(A) Structure of the transgene. (B and G) The 1 D2 ESC clone exhibits telence-
phalic-restricted expression at E14, and the localization of P/Sox2-EGFP ex-
pression is in the cell-dense neuroepithelium surrounding the lateral ventri-
cles but not in differentiating cells identified by ,3111-tubulin (red). (D) FACS
isolation of P/Sox2-EGFP high, low, and negative populationsfrom short-term
cultures derived from E14 fetuses. The total proportion of expressing cells
represents ~8% of the sorted population that was further subdivided based
on high and low expression levels. (E) Quantitation of Sox2 mRNA in popula-
tions with varying fluorescence intensity by real-time quantitative PCR, rela-
tive to the control Hprt message, exhibits correlation with fluorescence in-
tensity. Notably, the P/Sox2-EGFP- fraction still contains cells expressing
significant levels of Sox2 mRNA, indicating that the transgene marks only a
subset of cells that express the Sox2 gene. (,f) Selection of P/Sox2-EGFP-
expressing cells provides a 20-fold enrichment in neurosphere-initiating ac-
tivity over nonexpressing cells from cultured populations. (G) All clones de-
rived from single P/Sox2-EGFP cells are multipotent and differentiate into
neurons, astrocytes, and oligodendrocytes, as indicated by,B111-tubulin (red),
GFAP (purple), and RIP (green) immunoreactivity.
Sox2 mRNA exists in the P/Sox2-EGFP- population. Because
all nontelencephalic and nontransgenic cells derived from the
host blastocyst were previously eliminated on initiation of these
cultures, expression of Sox2 mRNA in the fluorescence-negative
fraction indicates that the S.S-kb element defines only a subset
of cells within a larger population that expresses the Sox2 gene.
P/Sox2 permits the isolation of NSCs from cultured telence-
phalic progenitor populations, as evidenced by an increase in the
number of neurospheres generated from P/Sox2-EGFP+ over
P/Sox2-EGFP- cells. We observed that 95% of the neuro-
sphere-initiating activity was found in the P/Sox2-EGFP-
expressing population (Fig. 1F). It was not feasible to perform
enrichment experiments from freshly isolated cells because of
the chimeric nature of the fetuses and the regional specificity of
11868 1 www.pnas.org/cgi/doi/10.1073/pnas.1834200100
biastocys
injection
chimeric embryo
NSCs
PlSox? def~ned
Clonally reiated
FACSi 3'
NSCS
s DIV ~
~.
5 ~lg RNA 5lng~e round IVT ~ ll9 RNA 5 ,ug RNA
~ _ _
_ Affymetrix platform _ _
_ _~ _~
X3 X3 X3
Three data analys~s methods ~
1) Microarray suite 4.0 (empirical) Genes determined
2) D-chip 1 0 (model-based) ~.:~ - dil'terentiaiin multiple ~:~:~ Genelists
3) Felix Naef algorithms (statistical) analysis methods
oct4 Re.\l. tv'tl1 ~,f4 Lttr :~ :-- N~:>s~,,, .~ox~ .~lof~ $~i
-~ak3 Ebafl Tdgfl EpI,AP ~- - :-- -> '-g~ .~(,.tf~2~-9fr
Sox2, Stat3, Statipl, Pias3, GH, G,~,t, Igfl, IgfEr, Notch3, Abcg~l, Abca2, Pea3, Rex3, Pax6
Fig. 2. Expression profiling experimental design. Three populations of cells
isolated by using FACS for P/Sox2-EGFP expression are compared. The three
populations are of clonal origin because they all originate from the 1 D2 clone
of P/Sox2-GIP ESCs by virtue of isolating the NSCs from E14 chimeric fetuses.
Three replicates for each population were derived from separate flasks of cells
and/or different pools of chimeric embryos. The Affymetrix platform was used
for generating expression profiles beginning with 5 ~g of total RNA for each
replicate. Three independent methods were used for data analysis, and the
genes found to be differential Iy expressed in mu Itiple methods are considered
to be different between populations with a very high degree of confidence.
Some of the expected genes found to be enriched in ESCs (red), NSCf (green),
and NSCc (blue) are listed, as well as genes that are expressed at equivalent
levels in all three populations (black).
expression of the P/Sox2 transgene. Thus, significant numbers of
neurosphere-initiating cells were observed in the EGFP- pop-
ulation in assays of freshly isolated cells.
In addition, P/Sox2-expressing cells are bona fide NSCs,
exhibiting the hallmarks of self-renewal and multilineage differ-
entiation when cultured as clonal isolates. P/Sox2-EGFP cells
were isolated by using FACS directly from the telencephalon of
E14 fetuses or from cultured populations derived from E14
telencephalon. Cells were plated individually into wells of 96-
well plates by limiting dilution. Proliferating clones derived from
single cells were dissociated after 7-14 DIV and replated into
96-well plates, where some wells were observed to contain a
single cell. Wells with single cells that gave rise to secondary
clones demonstrated the self-renewal capacity of P/Sox2-EGFP
cells. The secondary clones were expanded and differentiated to
verify that progeny of neuronal, astrocytic, and oligodendrocytic
lineages were produced (Fig. 1G ). We observed that 50%
(25/50) of single P/Sox2-EGFP+ cells isolated from culture gave
rise to primary clones, and single cell-derived secondary clones
were generated from every primary clone. Furthermore, all of
the secondary clones exhibited a multipotent character. Thus,
given the constraints on cell survival after FACS isolation, at
least 50% of P/Sox2-EGFP cells are SCs in vitro; this finding
validates the P/Sox2 approach for prospective isolation.
Expression Profiling of P/Sox2 Defined SCs. The availability of
P/Sox2 as a common molecular identifier for both ESCs and NSCs
allows for their isolation and thereby permits a direct transcriptional
profiling comparison between pluripotent and multipotent SCs,
respectively. An overview of the experimental design for transcrip-
tional profiling, as well as some of the observed transcripts that one
might expect, is illustrated in Fig. 2.
D'Amour and Gage
OCR for page 53
Table 1. Stringent matrix analysis defines a highly confident set of differentially expressed genes
ESC* NSC ESC* NSC Pluripotenti Multi-
Fold fresh- cultured- potent-
change Specific Enriched Depleted specific* Totals* Specific Enriched Depleted specific* Totals* Specific Enriched Depleted specific) Totalst
327 1,453 1 1 2t 199 ~ 97 1 58t 666
141 704 54 93 79 43 269
—1.4 1 55 273 372 312 1,1 12 249 474 403
—2.0 71 1 17 189 126 503 100 229 234
*The number and manner in which the highly confident, differentially expressed genes vary among ESC and NSCf or ESC and NSCc populations.
The union was taken of these two groups and represents those genes found to be differentially expressed between pluripotent and multipotent SCs.
"Complete lists are provided in Table 2.
The transcriptional profiling approach outlined above
yielded a very precise fingerprint of each SC population that
we then subjected to a very stringent matrix analysis paradigm
for identification of differential transcripts. This procedure
identified large numbers of differential transcripts among all
three populations of P/Sox2-defined SCs. As expected, the
overall difference was greater between ESC and either pop-
ulation of NSCs than between freshly isolated and cultured
NSC (NSCf and NSCc, respectively) populations. The majority
of the differences between ESC and NSCc were in fact not
shared between ESC and NSCf, and nearly 50% of the
differences between ESC and NSCf were unique as well (Table
14. However, the magnitude of transcriptional changes be-
tween freshly isolated P/Sox2-EGFP cells and those same cells
Table 2. Lists of pluripotent- and multipotent-specific genes by functional categories
grown for 5 DIV was unexpected. These changes may reflect
the further selection of a subset of P/Sox2-EGFP cells for
response to mitogenic stimulation. Indeed, one of the genes
found in NSCc and absent from NSCf was the E`gfr, indicative
of the proliferative recruitment in response to EGF. Despite
these changes in gene transcripts, there is consistency in
functional behavior with regard to the multipotent and pluri-
potent nature of the cells (see chimera analyses below). This
finding suggests that the genes found to be differentially
expressed between both ESC v. NSCf and ESC v. NSCc
represent the genes that are most reliably different between
pluripotent and multipotent SC classes. This difference
amounts to 666 genes at the level of 1.4-fold change and 269
at 2.0-fold (Table 1, Pluripotent), each detected with at least
Category n= 112 Pluripotent-specific n= 158 Multipotent-specific
Transcriptional
regulation
Chromatin
modulation
RNA binding
Growth factors
Receptors
Kinases and
phophotases
Cell cycle
Other signaling
molecules
Metabolism
Cell adhesion
Cytoskeleton
Toxic response
Vesicle traffic
Other
21
o
4
4
5
Oct4, Utfl, Rex1/2, Klf2/5, NrOb1, Crtr1, Pem, Stat6, Tcf7/15,
Rarg, El/2, Trim25, Tcea3, Aire, Gbx2, ESTs highly similar to
Tbx3, ESTs moderately similar to Znf41, ESTs weakly similar
to N kx2.5
None detected
Esg1, Rbms1, Dazl, ESTs similar to Rbpms
Fgf4, Tdgf1, Ebaf, Gdf3
F2r/1 (thrombin it-like 1), Sdfr2, Folate R1, Epha2, Tacstd1
0 None detected
4
3
15
Jak3, Hck, ESTs moderately similar to dual specificity kinase,
Inpp5d
Mkrn3, Stag3, Gste1
Ptch2, Upp, Annexin 1/11, Cish3, Serpine1, Gjb3, Spint1, Tfpi,
Als2, Ndrl, Ly75, Capipactin (Calgizzarin), ESTs highly similar
to Rsg5, ESTs moderately similar to interferon
12 Slc2a3/7a3/7a7/27a2/29a1/38a4, Gfpt2, Pfkp, Cox7a1, Apoc1,
Ddc, ESTs moderately similar to Slc39a4
6 Icam 1, Jcam 1, Ctgf, Spp 1, Endoglin, Jup,
Acta2, Tuba3, CD2-associated protein, Epb4, 114a, ESTs highly
similar to Desmoyokin
2 Mdrl, Epbx2
1 Stx3
7 B3gnt1, Fbxo15, Eifla, Pcolce, Crip, Col18a1, Nidogen
23 Bc13, Tc11, Trapla, Stra8, Mov10, Esau protein, Tex19, Tex20,
Tcstv1, two EST clusters highly similar to Tcstv1, ESTs highly
similar to CGI-83, ESTs moderately similar to
Plackophilin2/NDP52/DC12, ESTs weakly similar to WAP,
seven EST clusters of little or no homology
24 Foxg1, Nr2f1, Myt1, Zic1, Sox3/4/ 1 1, Brn 1/4, Mash 1, Hess,
Hey1, D/x1, Cutl1, Cbx4, ArxGtf2h1, Jun. Lmyc1, Id4,
mKF1, ESTs highly similar to Kruppel-like Zfp and Af9,
ESTs moderately similar to Zfp2
2 Sirt2, ESTs highly similar to Snf2a
3 Rbmx, Cupbp2, ESTs moderately similar to Rbm4
2 Pleiotropin, Igfbp5
8 Fgfr2, Notch1, Gpr56, Ptpra/g/o/z, ESTs highly similar to
thyroid hormone R alpha
10 Blbp, Fabpe, Syt11, GluR-B (and splice variant), Gria2,
Grik5, Clcn4-2, Kcnk2, Boct
10 Jak2, Ddr1, Hipk2, Tesk1, Pftk1, Snrk, Ptpn9, ESTs highly
similar to PKC-nu, PTK, and PP2A-beta
9 cyclin D2, p21 activated kinase 3, Nfia/x, Gas1, Gadd45g,
Septin 5, ESTs highly similar to Rgc32 and candidate
mediator of p53-dependent G2 arrest
18 Smo, Fzd2, Delta-like 1, Itgp, Pea15, Rgs2, Rab11a, ArEn,
Doub/ecortin, Dab1, Pkia, Edr2, adenylate cyclase 6,
Apba2/b 1, ESTs highly similar to Zfp289/B7-H3
7 Scp2, Pam, aSMase, Pafahlb2, dibydropyrimidinase-like
(Dpysl) 3/4, ESTs moderately similar to Dpysl4
9 Vcam1, Jcam3, Alcam, Pcdha4/6, Catenin alpha2/delta2,
Neuropilin, Kit ligand
2 Kif3a, Gephrin
0 None detected
4 Nsg1/2, Secretogranin 3, Sgne1
10 B4galt2, Efnb1, Gdap1, Psap, Mfap2, Ubl4, ESTs highly
similar to Ubp3, ESTs moderately similar to Stinp, ESTs
weakly similar to protein disulfide isomerase
40 Fjx1, Gpm6b, Neuroanatin, Lrrn1, Mpdz, Pard6a,
Tmdsf2/sf6,Sez6/17, Aig1, Edp1, Lmo1, Ssbp2, UGS148
protein, Eig180, Rnf42, ESTs highly similar to Tetraspan
met 2/Ptpz/KlAA0871 /FLJ 12750/MGC11 034, ESTs
weakly similar to Mucin2/Elastic titin/MGC3035,
1 5 ESTs
There are 1 12 genes determined to be present only in ESCs and differentially expressed at the 1 .4-fold change level between ESCs and both NSC populations.
Conversely, there are 158 genes present only in NSCf and NSCc and differentially expressed with ESCs. Transcription factors in bold were validated by RT-PCR
for presence/absence (see Fig. 4).
D'Amour and Gage
PNAS 1 September 30, 2003 1 vol. 100 1 suppl. 1 1 11869
OCR for page 54
two of three independent methods. This method of compari-
son highlights the large numbers of genes that may play ESCs
important roles in defining these two different levels of injected
SC potency. A logical place to begin further investigation is
with those genes that are not just enriched but completely
specific to each SC class, based on absence of expression using
gene chip determinations. The complete lists of pluripotent-
specific (n = 112) and multipotent-specific (n = 158) genes are
provided in Table 2. A fully searchable database for all NSCs
classifications of differential as well as nondifferential genes is injected
also provided (Table 3, which is published as supporting
information on the PNAS web site).
Chimera Analysis of P/Sox2 SC Populations. The large degree of
difference in transcriptional profiles between populations of SCs
that are clonally related and defined by identical molecular
criteria was surprising. However, the transcriptional profiles
represent a highly accurate molecular fingerprint of these SC
populations. Despite these drastic differences, we wanted to test
functionally for pluripotent behavior in the fetus-derived P/Sox2
populations by using chimera analyses. Functional confirmation
of the pluripotent and multipotent nature of these SC popula-
tions is crucial in light of the previous reports suggesting NSC
pluripotentiality (28, 29~.
The P/Sox2-EGFP cells used for chimera analyses were
isolated by using FACS from chimeric E14 fetuses (fresh),
short-term cultured P/Sox2 progenitors (one to two passages),
or long-term passaged clonal isolates (more than eight pas-
sages). Using morula aggregation (27), we observed that
P/Sox2 ESCs efficiently incorporated into the ICM (18/19),
whereas P/Sox2-derived neurospheres only adhered to the
outside of the embryo and never incorporated into the ICM
(0/24~. To circumvent a possible requirement for specific cell
surface interactions between the embryo and donor cells,
blastocyst injections were performed, because this method
places the injected cells directly in contact with the existing
ICM. After injection, blastocysts were returned to the incu-
bator for 2-4 h to allow reexpansion of the blastocoel cavity.
Embryos were examined by fluorescent microscopy to deter-
mine whether the injected cells had adhered to the ICM
surface (Fig. 3 A and D). A similar frequency of adherence to
the ICM was observed for ESCs and NSCs, and this frequency
was primarily dependent on injection technique. All embryos
were transferred into pseudopregnant females. Developing
fetuses were collected at E9.5, examined for P/Sox2-EGFP
expression (Fig. 3 B and E), and subsequently processed by
using X-Gal histochemistry for detection of any nontelence-
phalic chimerism (Fig. 3 C and F). Detection of nontelence-
phalic chimerism is possible because the parental ESC line
contains the LacZ gene expressed ubiquitously during devel-
opment from the ROSA26 locus (194. The lack of detected
chimerism for E14-derived NSCs is in sharp contrast to the
pluripotent character of the P/Sox2-EGFP ESCs. Even though
the NSCs adhered to the ICM of the blastocyst at the same
frequency as ESCs, they were definitely not pluripotent, as
demonstrated by the complete lack of chimerism in 76 embryos
analyzed at E9.5, irrespective of time spent in vitro. The
number of embryos recovered after blastocyst injection and
transfer to pseudopregnant females was equivalent for ESCs
(64%) and NSCs (56~o), indicating that the injected NSCs do
not elicit toxicity in the developing embryos (Fig. 3G). In total,
100 events of chimeric potential were analyzed by the two
chimera methods combined for P/Sox2-defined NSCs after
varying periods of in vitro culture. The complete lack of
detectable chimerism is in sharp contrast to the robust chi-
meric contribution achieved with P/Sox2-defined ESCs. This
convincing demonstration that the multipotent NSCs clearly
11870 1 www.pnas.org/cgi/doi/10. 1 073/pnas. 1834200100
1~191ad - mnce P/Sox2-EGFP ROSA26 LacZ
l
( _
`;1 Summarv of blastocYst iniection results
Donor Cell Type Blastoevsts Iniected Embrvos Recovered Chimeric
NSC s
fresh
cultured
passaged
Total
45
48
42
135
25 (56)
26 (54)
25 (60)
76 (56)
0~25 (0)
OI26 (O)
0~25 (0)
on6 (o)
ESCs 108 69 (64) 51~61 (84)
Fig. 3. Only P/Sox2-EGFP-defined ESCs are pluripotent. P/Sox2-defined ESCs
and NSCs were injected into blastocysts followed by analysis at E3.5 and E9.5
time points. (A and D) There is a similar frequency of adherence to the ICM for
ESCs and NSCs injected into blastocysts. Only ESCs participate in development
to form highly chimeric embryos at E9.5 (B and C), whereas the P/Sox2-EGFP
cells derived from E14 fetuses do not exhibit chimerism to any tissues (E and
F). (G) The numbers of blastocysts injected and E9.5 embryos recovered are
presented for P/Sox2-defined NSCs and ESCs. The frequency of recovering an
E9.5 embryo is equivalent for NSC and ESC injections, indicating that no
toxicity is imparted by the injected NSCs. Therefore, the lack of chimerism in
the 76 NSC-injected embryos functionally identifies these P/Sox2-EGFP+ cells
distinctly as multipotent SCs.
lack the hallmark abilities of pluripotent ESCs supports the use
of these genetic comparisons for further studies of SC potency.
Verification of Presence/Absence by Qualitative RT-PCR. Functional
verification of the pluripotent and multipotent character of
these SC populations identifies the differentially transcribed
genes as molecular correlates of this difference. Of particular
interest on this list are genes that are present in ESCs and
absent from NSCs, because these genes may function specif-
ically in the establishment or maintenance of the pluripotent
state. Transcription factors were chosen for the first level of
analysis because of their commonly described roles in regula-
tion of cell fates and differentiation. As might be expected, the
gene encoding the transcription factor Oct4 is at the top of the
list with regard to fold change, because it is highly expressed
in ESCs and absent from NSCs. The pivotal role of Oct4 in
both specification and maintenance of the pluripotent pheno-
type has already been shown (15~. Groups of transcription
factors that exhibited a gene chip-predicted present/absent
pattern in either ESCs or NSCs (bold in Table 2) were chosen
for further analysis.
To verify the presence and absence of these genes in their
respective compartments, we used qualitative RT-PCR with up
to 40 cycles of amplification for a much more sensitive method
of detecting rare transcripts. In addition, for RT-PCR verifica-
tion we used samples that were prepared by FACS isolation in
the same manner but independent from those used for tran-
scriptional profiling. All genes except Zicl exhibited strong
differential expression by RT-PCR in the same direction as
predicted by gene chip analysis. The detection of completely
ESC-specific transcripts was verified for seven of eight genes,
with Klf4 being the exception, because a small amount of
message was detectable in the NSC population (Fig. 4~. The
RT-PCR results confirmed the differential nature of these genes
D'Amour and Gage
OCR for page 55
ES cell NSC
-
+ ~
Klf~
NrOb,
Klf.6
Klf4 I_
Rr~x7
ES cell NSC
RT + - + - RT
_ _ .
Ox(~ 1
Nr2f1
Zic1
Myt1
Gapd
Actb
Fig. 4. RT-PCR confirmation of presence/absence in ESC and NSC popula-
tions. Groups of SC class-specific transcription factors of high confidence (2.0
or greater fold change) were assayed by RT-PCR as a more sensitive method for
detection of rare transcripts. Most of the ESC-specific genes were verifiably
absent in NSCs. Only two of four NSC-specific genes were found absent from
ESCs. Gapdh and ,B-actin gene signals are approximately the same, indicating
an equivalent input for both cell types.
but highlighted the need for additional methods of verification
for presence/absence determinations.
Discussion
Here we report the development of an approach based on the
Sox2 promoter for the isolation and comparison of NSCs and
ESCs. The P/Sox2 transgene is expressed exclusively in ESCs
and the immature neuroopithelium of the fetal telencephalon,
thus allowing prospective isolation of both populations by FACS.
Selection of P/Sox2-EGFP cells from fetal mice enriches for
neurosphere-initiating activity, and individually plated cells have
NSC function. The transcriptional profiles of clonally related
NSCs and ESCs defined by P/Sox2-EGFP expression were
compared. This comparison revealed an extraordinary degree of
difference between these pluripotent and multipotent SC pop-
ulations. To ensure that the fetus derived P/Sox2-EGFP popu-
lations do not exhibit pluripotent character, despite their dras-
tically different genetic profiles, these cells were aggregated with
morula-stage embryos or injected into blastocysts. This assay
functionally demonstrates the multipotent and pluripotent char-
acter of the P/Sox2-defined NSC and ESC populations, respec-
tively, and validates the differentially expressed genes as poten-
tial molecular correlates of this functional difference.
Recently, two other groups have reported expression profiling
comparisons between ESCs and multipotent SCs (30, 314. This
report differs from those in that it focuses on elucidating the
differences between these SC populations rather than seeking a
common transcriptional profile that may be attributable to
"stemness." In addition, there are several important aspects of
our transcriptional profiling approach that contribute to making
it the most accurate and reliable comparison of NSCs and ESCs
1. Weissman, 1. L. (2000) Science 2X7, 1442-1446.
2. Wulf, G. G., Jackson, K. A. & Goodell, M. A. (2001) Exp. Hematol. 29,
1361-1370.
3. Wagers, A. J., Sherwood, R. I., Christensen, J. L. & Weissman, I. L. (2002)
Science 297, 2256-2259.
4. Morshead, C. M., Benveniste, P., Iscove, N. N. & van der Kooy, D. (2002) Nat.
Med. 8, 268-274.
5. Brazelton, T. R., Rossi, F. M. V., Keshet, G. I. & Blau, H. M. (2000) Science
290, 1775-1779.
6. Bjornson, C. R. R., Rietze, R. L., Reynolds, B. A., Magli, M. C. & Vescovi, A. L.
(1999) Science 283, 534-537.
7. Anderson, D. J., Gage, F. H. & Weissman, I. L. (2001) Nat. Med. 7, 393-395.
8. Collignon, J., Sockanathan, S., Hacker, A., Cohen-Tannoudji, M., Norris, D.,
Rastan, S., Stevanovic, M., Goodfellow, P. N. & Lovell-Badge, R. (1996)
Development (Cambridge, U.K) 122, 509-520.
9. Li, M., Pevny, L., Lovell-Badge, R. & Smith, A. (1998) Curr. Biol. 8,
971-974.
D'Amour and Gage
reported to date. First, because P/Sox2 is down-regulated in the
differentiating progeny of both ESCs and NSCs, the selection of
P/Sox2-expressing cells provides a more homogeneous popula-
tion for each SC and defines these populations by identical
criteria (Fig. 5, which is published as supporting information on
the PNAS web site). Purification eliminates the need to remove
the "differentiation genes" that are expressed in heterogeneous
SC populations. Performing direct comparisons between the
entire transcriptome of ESCs and NSCs adds power to the
comparison, because removing "differentiation genes" from
comparative analysis has no biological rationale. The fact that a
gene is expressed in both the SC and its differentiating progeny
does not exclude it from having functional importance to that
SC's "genetic program." Second, because the NSCs are isolated
from chimeric fetuses, populations are provided that share
identical genomes, because they are all derived from the same
ESC clone. This feature will eliminate the variability in gene
transcription that arises from genomic heterogeneity (244. Third,
this isolation method permits, for the first time, the analysis of
both freshly isolated and cultured NSC populations. Fourth,
because populations can be acquired in sufficient quantity, this
method eliminates the need for multiple rounds of in vitro
transcription (IVT). Single-round IVT better maintains the 5'
complexity of cRNA and reduces the introduction of data biases
that accompany multiple-round IVT protocols (32~. Fifth, the
use of three independent data analysis methods for determina-
tions of differential transcripts adds an additional level of
confidence to the gene lists.
In conclusion, we have presented a transgenic approach that
uses a common property of SCs for the purification of multipo-
tent NSC and pluripotent ESC populations to generate direct
genetic and functional comparisons between these two SC
classes. These comparisons have underscored the genetic dis-
similarity between functionally verified multipotent and pluri-
potent populations, providing new avenues for investigation of
the biology underlying the control of cellular potency.
Note Added in Proof. Two groups recently described a novel homeobox
transcription factor, Nanog, that plays a functionally essential role in
maintaining the pluripotent state of ESCs (33, 34~. This gene was one of
the most highly pluripotent-specific transcripts detected in our gene chip
analyses at the level of—2.0-fold change, and in this report is classified
in Table 2 as one of the "seven EST clusters of little or no homology."
It may be identified in Table 3 by probe set ID numbers 161072 at and
161653] at or by query for UniGene number Mm.6047.
We thank the following people from The Salk Institute's core facilities
for their invaluable services: M. Baker of DNA sequencing and quan-
titative PCR, A. Garcia of functional genomics, and D. Chambers and
J. Barra of the flow cytometry core. We thank B. Aimone, V. Chu,
and J. Hsieh for valuable assistance with expression profile data analysis,
and W. Deng, M. L. Gage, and K. Nakashima for their critical reading
of the manuscript.
10. Nishimoto, M., Fukushima, A., Okuda, A. & Muramatsu, M. (1999) Mol. Cell.
Biol. 19, 5453-5465.
11. Yuan, H., Corbi, N., Basilico, C. & Dailey, L. (1995) Genes Dev. 9, 2635-2645.
12. Ambrosetti, D.-C., Basilico, C. & Dailey, L. (1997) Mol. Cell. Biol. 17,
6321-6329.
13. Botquin, V., Hess, H., Fuhrmann, G., Anastassiadis, C., Gross, M. K., Vriend,
G. & Scholer, H. R. (1998) Genes Dev. 12, 2073-2090.
14. Nichols, J., Zevnik, B., Anastassiadis, K., Niwa, H., Klewe-Nebenius, D.,
Chambers, I., Scholer, H. & Smith, A. (1998) Cell 95, 379-390.
15. Niwa, H. J., Miyazaki, J. & Smith, A. G. (2000) Nat. Genet. 24, 372-376.
16. Wood, H. B. & Episkopou, V. (1999) Mech. Dev. 86, 197-201.
17. Zappone, M. V., Galli, R., Catena, R., Meani, N., De Biasi, S., Mattei, E.,
Tiveron, C., Vescovi, A. L., Lovell-Badge, R., Ottolenghi, S. & Nicolis, S. K.
(2000) Development (Cambridge, U.K) 127, 2367-2382.
18. Wiebe, M. S., Wilder, P. J., Kelly, D. & Rizzino, A. (2000) Gene 246,
383-393.
19. Friedrich, G. & Soriano, P. (1991) Genes Dev. 5, 1513-1523.
PNAS 1 September 30, 2003 1 vol. 100 1 suppl. 1 1 11871
OCR for page 56
20. Hogan, B. L., Beddington, R., Costantini, F. & Lacy, E. (1994) Manipulating
the Mouse Embryo: A Laboratory Manual (Cold Spring Harbor Lab. Press,
Plainview, NY).
21. Zhao, X., Lein, E. S., He, A., Smith, S. C., Aston, C. & Gage, F. H. (20()1)
J. Comp. Neurol. 441,187-196.
22. Palmer, T. D., Markakis, E. A., Willhoite, A. R., Safar, F. & Gage, F. H. (1999)
J. Neurosci. 19, 8487-8497.
23. Wodicka, L., Dong, H., Mitimann, M., Ho, M. H. & Lockhart, D. J. (1997)Nat.
Biotechnol. 15, 1359-1367.
24. Sandberg, R., Yasuda, R., Pankratz, D. G., Carter, T. A., Del Rio, J. A.,
Wodicka, L., Mayford, M., Lockhart, D. J. & Barlow, C. (200()) Proc. Natl.
Acad. Sci. USA 97, 11038-11043.
25. Naef, F., Hacker, C. R., Patil, N. & Magnasco, M. (2()()2) Cenon~e Biol. 3,
RESEARCH0018.1-()Ol S. 11.
26. Li, C. & Wong, W. H. (2001) Proc. Natl. Acad. Sci. USA 98, 31-36.
11872 1 www.pnas.org/cgi/doi/10. 1 073/pnas.1834200100
27. Khillan, J. S. & Bao, Y. (1997) BioTechniques 22, 544-549.
28. Clarke, D. L., Johansson, C. B., Wilbertz, J., Veress, B., Nilsson, E., Karlstrom,
H., Lendahl, U. & Frisen, J. (2000) Science 288, 1660-1663.
29. Reitze, R. L., Valcanis, H., Brooker, G. F., Thomas, T., Voss, A. K. & Bartlett,
P. F. (2001) Nature 412, 736-739.
30. Ramalho-Santos, M., Yoon, S., Matsuzaki, Y., Mulligan, R. C. & Melton, D. A.
(2002) Science 298, 597-600.
31. Ivanova, N. B., Dimos, J. T., Schaniel, C., Hackney, J. A., Moore, K. A. &
Lemischka, I. R. (2002) Science 298, 6001-6604.
32. Baugh, L. R., Hill, A. A., Brown, E. L. & Hunter, C. P. (2001) N~'cleic Acids
Res. 29, e29.
33. Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K.,
Maruyama, M., Maeda, M. & Ymanaka, S. (2003) Cell 113, 631-642.
34. Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S. &
Smith, A. (2003) Cell 113, 643-655.
D'Amour and Gage
Representative terms from entire chapter:
ests highly
