National Academy of Sciences | 150 Year Anniversary

Questions? Call 800-624-6242

| Items in cart [0]

The National Academies Press

PAPERBACK
price:$39.25
add to cart

Rights & Permissions

topleft topright

Mapping and Sequencing the Human Genome (1988)
Commission on Life Sciences (CLS)

Citation Manager

. "2 Introduction ." Mapping and Sequencing the Human Genome. Washington, DC: The National Academies Press, 1988.

Please select a format:

BibTeX EndNote RefMan


Page
12
bottomleft bottomright
Page
12

Below are the first 10 and last 10 pages of uncorrected machine-read text (when available) of this chapter, followed by the top 30 algorithmically extracted key phrases from the chapter as a whole.
Intended to provide our own search engines and external engines with highly rich, chapter-representative searchable text on the opening pages of each chapter. Because it is UNCORRECTED material, please consider the following text as a useful but insufficient proxy for the authoritative book pages.

Do not use for reproduction, copying, pasting, or reading; exclusively for search engines.

OCR for page 12
Introduction All living organisms are composed of cells, each no wider than a human hair. Each of our cells contains the same complement of DNA constituting the human genome (Figure 1-1.) The DNA sequence of every person's genome is the blueprint for his or her development from a single cell to a complex, integrated organism that is composed of more than 10~3 (10 million million) cells. Encoded in the DNA sequence are fundamental determinants of those mental capacities- learning, language, memory essential to human culture. Encoded there as well are the mutations and variations that cause or increase susceptibility to many diseases responsible for much human suffering. Unprecedented advances in molecular and cellular biology, in bio- chemistry, in genetics, and in structural biology-occurring at an accelerating rate over the past decade define this as a unique and opportune moment in our history: For the first time we can envision obtaining easy access to the complete sequence of the 3 billion nucleotides in human DNA and deciphering much of the information contained therein. Converging developments in recombinant DNA technology and genetics make obtaining a complete ordered DNA clone collection indexed to the human genetic linkage map a realistic immediate goal. Even determination of the complete nucleotide sequence is attainable, although ambitious. The DNA in the human genome is remarkably stable, as it must be to provide a reliable blueprint for building a new organism. For this reason, obtaining complete genetic linkage and physical maps and deciphering the sequence will provide a permanent base of knowledge concerning all human beings- a base whose utility for all activities of biology and 12

OCR for page 13
INTROD UCTION 13 medicine will increase with future analysis, research, and experimen- tation. Even the complete sequence of DNA in the human genome will not by itself explain human biology. It will, however, serve as a great resource, an essential data bank, facilitating future research in mam- malian biology and medicine. Humans, like all living organisms, are composed largely of proteins. For humans these are roughly estimated to be of 100,000 different kinds. In general, each gene codes for the production of a single protein, and a gene and its protein can be related to each other by means of the genetic code. Therefore, scientists will be able to turn to the DNA sequence of the human genome and obtain detailed information on both the structure and function of any gene or protein of interest. In addition, all genes and proteins will be classified into large family groups that provide valuable clues to their functions. In this way, many previously unknown human genes and proteins will become available for biochemical, physiolog- ical, and medical studies. The knowledge gained will have a major impact on health care and disease prevention; it will also raise challenging issues regarding rational, wise, and ethical uses of science and technology. GENOMES, GENES, AND GENOMIC MAPS To understand the importance of knowledge about the human genome, one must first understand the genome s functions. Genomes Consist of DNA Molecules That Contain Many Genes The genome of all living organisms consists of DNA, a very long two-stranded chemical polymer (Figure 2-11. Each DNA strand is composed of four different units, called nucleotides, that are linked end to end to form a long chain (Figure 2-2~. These four nucleotides are symbolized as A, G. C, and T. which stand for the four bases- adenine, guanine, cytosine, and thymine that are parts of the nu- cleotides. One DNA molecule, which together with some associated proteins constitutes a chromosome, differs from another in its length and in the order of its nucleotides. Each DNA molecule contains many genes, which are its functional units. These genes are arranged in a defined order along the DNA molecule. Most genes code for protein molecules- enzymes or structural elements-that determine the characteristics of a cell. In bacteria, the coding sequences of a gene.are continuous strings of nucleotides, but in mammals the coding segments in a gene (called exons) are generally separated from one

OCR for page 14
14 C, - E ~ in ~ C) A s Q C7 o s O Q I Q C;5 y ~ IS U) ~ _ ~ ~ E E . C') ~ ~ I N~<= / ~ ;$~ e ~ ~C ~ W~~,~ ~ {~\ ~ ~ ~ ~ ~ 3° ~V Am ~ V Z CO Q ._ Q - ~0 ~ Z ~ r~ ~ C) O o _ ~ ~ ~ ~ _ O C ~ Ct O L' . C ~ O ·_ C) tt _ ~ O V:) ·- O c: ~ O O C' os ~ "C ~ . _ _ e ~3 ~> C'7 ~ ~ ·- C~ o ~ , Q ._ C o Q ~ . o ~ ~ c) ct X Q ~ - £ o C~ Ct o ~ ~ C~ o ~ £ £ - -~ ° £ C) ~ o ,= ~ ~ ~ ~ ~. C ~ ·- C o ~ 3 _ - CC: ,= ._ . ~ Q 3 ~ o C~

OCR for page 15
l ~ 1 ~ () r o\ _ ~ ~ \'O , ~ \ ID a, _ ~ ~ Z ~ 00 C ° A, D O _ t O O ' 3 4' C ~ ~ ~ _ ~ ~ D ~ ~ o D O ~ Ce ,= (~) -o 0 ·- ~ 4,) ~ 4, 3 ~ c' ~ ~ ~ C, ~ . ° ._ ~ ~ D V) ~ pL] E O Ct v, ~ 3 S V, C ~ TIC "C o C C Cat ·Ct ~ 5 ~ ~ - , ~ ~ O C ~ ~ Q O ~ ·- ~ O C) E ~ c Ha o o o . C- ~ cry ~ ~ Q o C _ 04 of - C~0 ~ tV C E_ ~ . ~ C E~ ce ° · ce ~ c~ Cn D I C ,C ,C C ~ 3 . f:1,~ ~) D ~- ~ ~ V ~ ~ ~ :, ~ ct 3 ~ =° \ 1'WGI, °'~- ° o (~°-~\\o °\ \ o o' C o' ~ o U' 1 C~ C cn o I ~ > / I Z IlllllIIII O / \\ ._ ~ ~I ~ s / 0 0111111111 I Z \ // \

OCR for page 16
16 MAPPING AND SEQUENCING THE HUMAN GENOME another by noncoding segments (called introns) (Figure 2-31. Often each exon will encode a different structural region (or domain) of a larger protein molecule. Many exons have been found to be part of a family of related coding sequences that are used in the construction of many different genes (Doolittle et al., 19861. Because of the many introns in mammalian genes, a single gene is often more than than 10,000 nucleotides long, and genes that span 100,000 nucleotides are not uncommon (Table 2-11. For the information in the coding sequences of a gene to be expressed, the DNA of a gene must first be transcribed into an RNA molecule (Figure 2-31. Before the RNA strand leaves the cell's nucleus, the intron sequences are cut out of this RNA strand by a process called RNA splicing, thereby bringing the exon sequences into con- tiguity. Then the RNA can be translated into a protein molecule according to the genetic code (every group of three nucleotides codes for one amino acid). Nucleotide sequences adjacent to the coding sequences in each gene encode regulatory signals for activating or inactivating transcription of the gene. Gene activity is a dynamic process; at any given time and in any given cell type, only a subset of genes is active. These active genes determine the course of embryological development and the characteristics of cells and or- ganisms. The Human Genome Is Composed of 24 Different Types of DNA Molecules Human DNA is packaged into physically separate units called chromosomes. Humans are diploid organisms, containing two sets of genetic information, one set inherited from the mother and one from the father. Thus, each somatic cell has 22 pairs of chromosomes called autosomes (one member of each pair from each parent) and two sex chromosomes (an X and a Y chromosome in males and two X chromosomes in females). Each chromosome contains a single very long, linear DNA molecule. In the smallest human chromosomes this DNA molecule is composed of about 50 million nucleotide pairs; the largest chromosomes contain some 250 million nucleotide pairs. The diploid human genome is thus composed of 46 DNA molecules of 24 distinct types. Because human chromosomes exist in pairs that are almost identical, only 3 billion nucleotide pairs (the haploid genome) need to be sequenced to gain complete information concerning a representative human genome. The human genome is thus said to contain 3 billion nucleotide pairs, even though most human cells contain 6 billion nucleotide pairs.

OCR for page 17
INTROD UCTION TABLE 2-1 The Size of Some Human Genes Gene Size mRNA Size - (in thou- (in thou sands of sands of Number of Gene nucleotides) nucleotides) Introns Small Alpha globin 0.8 O.S 2 Beta globin - 1.5 0.6 2 Insulin 1.7 0.4 2 Apolipoprotein E 3.6 1.2 3 Parathyroid 4.2 1.0 ~ Protein kinase C 11 1.4 7 Medium Collagen I Pro-alpha-1 (I) Pro-alpha-2(I) Albumin H~gh-mobility group CoA reductase Adenosine deaminase Factor IX Catalase Low-density 18 5 50 38 5 50 2.1 14 25 25 32 34 34 4.2 1.5 2.8 1.6 12 . lipoprotein receptor 45 5.5 17 Large Phenylalanine hydroxylase Factor VIII Thyroglobulin Very large Duchenne muscular dystrophy 90 2.412 186 925 300 8.736 >2,000 ~ 17~50 a Table provided by Victor McKusick. 17 DNA is a double helix: Each nucleotide on a strand of DNA has a complementary nucleotide on the other strand. The information on one DNA strand is therefore redundant to that on the other (that is because of complementary base pairing (Figure 2-2A), one can in principle determine the nucleotide sequence of one strand from the other). However, it is currently necessary to determine the sequences of the nucleotides on the two DNA strands separately to achieve the

OCR for page 18
8 c h r o m o s o m e c o n b l n l n g ~ \ \ \ \ \ Noncoding region, including a regulatory region Primal RNA transcript Messenger RNA (mRNA) Protein MAPPING AND SEQUENCING THE HUMAN GENOME Exon Exon Exon Exon · _t t . . . ~ ~ Noncoding Intron Intron Intron region Transcriotion RNA Splicing Translation FIGURE 2-3 How genes are expressed in human cells. Each gene can specify the synthesis of a particular protein. Whether a gene is off or on depends on signals that act on the regulatory region of the gene. When the gene is on, the entire gene is transcribed into a large RNA molecule (primary RNA transcript). This RNA molecule carries the same genetic information as the region of DNA from which it is transcribed because its sequence of nucleotides is determined by complementary nucleotide pairing to the DNA during RNA synthesis. The RNA quickly undergoes a reaction called RNA splicing that removes all of its intron sequences and joins together its coding sequences (its exons). This produces a messenger RNA (mRNA) molecule. The RNA chain is then used to direct the sequence of a protein (translation) according to the genetic code in which every three nucleotides (a codon) specifies one subunit (an amino acid) in the protein chain. desired accuracy of any DNA sequence, with the sequence of each strand being used as a check on the other. For this reason, a total of 6 billion nucleotides must actually be sequenced to order the 3 billion nucleotide pairs in the haploid human genome. The average size of a protein molecule allows one to predict that there are approximately 1,000 nucleotide pairs of coding sequence per gene. Since humans are thought to have about 100,000 genes, a total of about 100 million nucleotide pairs of coding DNA must be present

OCR for page 19
INTROD UCTION 19 in the human genome. That this is only about 3 percent of the total size of the genome leads one to conclude that less than 5 percent of the human genome codes for proteins. The vast bulk of human DNA lies between genes and in the introns. Some of the noncoding DNA plays a role in regulating gene activity, while other portions are believed to be important for organizing the DNA into chromosomes and for chromosome replication (Alberta et al., 1983; Lewin, 1987~. The function of most noncoding regions of the human genome, however, is unknown; much of this DNA may have no function at all. The Human Grenome (:an Be Mapped in Many Different Ways It would be enormously useful to determine the order and spacing of all the genes that make up the genome. Such information is said to constitute a gene or genome map. Since there are 24 different DNA molecules in the human genome, a complete human gene map consists of 24 maps, each in the linear form of the DNA molecule itself. One type of useful genome map is the messenger RNA (mRNA) or exon map. Cellular enzymes transcribe or copy all of an organism's genes into mRNAs so that the functions of the genes can be expressed. Complementary DNA (cDNA) of all the mRNAs present in an organism can be synthesized enzymatically with reverse transcriptase. These cDNAs can then be cloned and used to locate the corresponding genes on a chromosome map. In this way, the genes can be mapped in the absence of knowledge of their function. Another type of genome map would consist of an ordered set of the overlapping DNA clones that constitute an entire chromosome. Both the exon map and the ordered set of DNA clones are usually referred to as physical maps. Alternatively, the position of a gene can be mapped by following the effect of the expression of the gene on the cells containing it. Here, a map is constructed on the basis of the frequencies of coinheritance of two or more genetic markers. This type of map is referred to as a genetic linkage map. The distinction between physical and genetic linkage maps is discussed in detail in Chapter 4. Maps of the human genome can be made at many different scales, or levels of resolution. Low-resolution physical maps have been derived from the distinctive patterns of bands that are observed along each chromosome by light microscopy of stained chromosomes. Genes have been physically associated with particular bands or clusters of bands in a number of ways. These associations permit genes to be mapped only approximately since a given gene might be assigned to a region of about 10 million nucleotides containing several hundred

OCR for page 20
20 MAPPING AND SEQUENCING THE [IUMAN GENOME genes. Its exact position on the chromosome must be determined by more precise methocis. Maps of higher resolution are based on sites in the DNA cut by special proteins called restriction enzymes. Each enzyme recognizes a specific short sequence of four to eight nucleotides (a restriction site) and cuts the DNA chain at one point within the sequence (Watson e! al., 19834. Since dozens of different sequences are recognized by one or another enzyme, and these sequences are closely spaced throughout the genome, high-resolution physical maps can be con- structed by determining the relative location of different restriction sites precisely. Of particular value in human gene mapping are restriction sites that are highly variable (or polymorphic) in the population. DNA lacking a specific restriction site yields a larger restriction fragment when cut by the enzyme than DNA containing the site; hence, the designation restriction fragment length polymorph- ism (REDIP). Hundreds of polymorphic restriction sites have so far been identified and mapped in the human genome. Some disease- related genes have already been localized by determining the frequency of coinheritance of RF~Ps anti genetic diseases (GuselIa et a/., 1983~. Examples of these diseases include cystic fibrosis, Duchenne muscular dystrophy, Alzheimer's disease, and neurofibromatosis. Identifying a much larger number of useful polymorphic restriction sites should make it possible to map disease-related genes precisely enough to greatly facilitate the isolation of any human gene. The map based on a collection of ordered clones of genomic fragments has a special value (see Chapter 41. In such a map, not only are the genomic positions of restriction fragments known, but each fragment is available as a clone that can be propagated and distributed to interested researchers. Such clones are immensely valuable because they serve as the starting point for gene isolation, for functional analyses, and for the determination of nucleotide sequences. The ultimate, highest resolution map of the human genome is the nucleotide sequence, in which the identity and location of each of 3 billion nucleotide pairs is known (see Chapter 51. Only such a sequence reveals all or nearly all the information in the human genome. A number of specific regions of human DNA have already been analyzed in this way, providing information about the structure of genes and their encoded proteins in both normal and abnormal individuals and about sequences that regulate gene expression (Figure 2-41. At present, however, the nucleoticie sequence of substantially less than 0.1 percent of the human genome is known. This includes the sequence containing 0.5 percent of our genes.

OCR for page 21
INTROD UCTION CCCTGTGGAGCCACACCCTAGGGTTGGCCA ATCTACTCCCAGGAGCAGGGAGGGCAGGAG CCAGGGCTGGGCATAAAAGTCAGGGCAGAG CCATCTATTGCTTACATTTGCTTCTGACAC AACTGTGTTCACTAGCAACTCAAACAGACA CCATGGTGCACCTGACTCCTGAGGAGAAGT CTGCCGTTACTGCCCTGTGGGGCAAGGTGA ACGTGGATGAAGTTGGTGGTGAGGCCCTGG GCAGGTTGGTATCAAGGTTACAAGACAGGT TTAAGGAGACCAATAGAAACTGGGCATGTG GAGACAGAGAAGACTCTTGGGTTTCTGATA GGCACT GACTC T CT CT GCCTATTGGT CTAT TTTCCCACCCTTAGGCTGCTGGTGGTCTAC CCTTGGACCCAGAGGTTCTTTGAGTCCTTT GGGGATCTGTCCACTCCTGATvCTGTTATG GGCAACCCTAAGGTGAAGGCTCATGGCAAG AAAGTGCTCGGTGCCTTTAGTGATGGCCTG GCTCACCTGGACAACCTCAAGGGCACCTTT GCCACACTGAGTGAGCTGCACTGTGACAAG CTGCACGTGGATCCTGAGAACTTCAGGGTG AGTCTATGGGACCCTTGATGTTTTCTTTCC CCTTCTTTTCTATGGTTAAGTTCATGTCAT AGGAAGGGGAGAAGTAACAGGGTACAGTTT AGAATGGGAAACAGACGAATGATTGCATCA GTGTGGAAGTCTCAGGATCGTTTTAGTTTC TTTTATTTGCTGTTCATAACAATTGTTTTC TTTTGTTTAATTCTTGCTTTCTTTTTTTTT CTTCTCCGCAATTTTTACTATTATACTTAA TGCCTTAACATTGTGTATAACAAAAGGMA TATCTCTGAGATACATTAAGTAACTTAAAA AAAAACTTTACACAGTCTGCCTAGTACATT ACTATTTGGAATATATGTGTGCTTATTTGC ATATTCATAATCTCCCTACTTTATTTTCTT TTATTTTTAATTGATACATAATCATTATAC ATATTTATGGGTTAAAGTGTAATGTTTTAA TATGTGTACACATATTGACCAAATCAGGGT AATTTTGCATTTGTAATTTTAAAAAATGCT TTCTTCTTTTAATATACTTTTTTGTTTATC TTATTTCTAATACTTTCCCTAATCTCTTTC TTTCAGGGCAATAATGATACAATGTATCAT GCCTCTTTGCACCATTCTAAAGAATAACAG TGATAATTTCTGGGTTAAGGCAATAGCAAT ATTTCTGCATATAAATATTTCTGCATATAA ATTGTAACTGATGTAAGAGGTTTCATATTG CTAATAGCAGCTACAATCCAGCTACCATTC TGCTTTTATTTTATGGTTGGGATAAGGCTG GATTATTCTGAGTCCAAGCTAGGCCCTTTT GCTAATCATGTTCATACCTCTTATCTTCCT CCCACAGCTCCTGGGCAACGTGCTGGTCTG TGTGCTGGCCCATCACTTTGGCAAAGAATT CACCCCACCAGTGCAGGCTGCCTATCAGAA AGTGGTGGCTGGTGTGGCTAATGCCCTGGC CCACAAGTATCACTAAGCTCGCTTTCTTGC TGTCCAATTTCTATTAAAGGTTCCTTTGTT CCCTAAGTCCAACTACTAAACTGGGGGATA TTATGAAGGGCCTTGAGCATCTGGATTCTG CCTAATAAAAAACATTTATTTTCATTGCAA TGATGTATTTAAATTATTTCTGAATATTTT ACTAAAAAGGGAATGTGGGAGGTCAGTGCA TTTAAAACATAAAGAAATGATGAGCTG'rTC AAACCTTGGGAAAATACACTATATCTTAAA CTCCATGAAAGAAGGTGAGGCTGCAACCAG CTAATGCACATTGGCAACAGCCCCTGATGC CTATGCCTTATTCATCCCTCAGAAAAGGAT TCTTGTAGAGGCTTGATTTGCAGGTTAAAG TTTTGCTATGCTGTATTTTACATTACTTAT TGTTTTAGCTGTCCTCATGAATGTCTTTTC 21 FIGURE 2-4 The DNA sequence of the human gene for beta-globin (a protein of 146 amino acids that forms part of the hemoglobin molecule that carries oxygen in the blood). The sequence of only one of the two DNA strands is given since the other one has a precisely complementary sequence The sequence should be read from left to right in sueees- sive lines down the page. as if it were normal text. The human genome is about 2 million times as long as this small gene of 1,500 nueleotides (see Table 2- 1), which contains three exons and two introns (the boundaries between exons and introns are not indi- cated here). Reprinted, with permission. from Alberts et al. (1989).

OCR for page 22
22 MAPPING AND SEQUENCING THE HUMAN GENOME MEDICAL IMPLICATIONS OF DETAILED HUMAN GENOME MAPS Advances in molecular genetics made over the past two decades are already having a major impact on medical research and clinical care. The ability to clone and analyze individual genes and to deduce the amino acid sequences of encoded proteins has greatly increased our understanding of genetic disorders, the immune system, endocrine abnormalities, coronary artery disease, infectious diseases, and can- cer. A few proteins produced on a commercial scale by recombinant DNA methods are available for therapeutic use or in clinical trials, and many more are in earlier developmental stages. Recent progress in determining the genetic basis for such neurological and behavioral disorders as Huntington's disease (GuselIa et al., 1983), Alzheimer's disease (St George-HysIop et al., 1987), and manic-depressive illness (Egeland et at 1987) promises new insights into these common and serious conditions. Higher resolution maps of the human genome will accelerate progress in understanding disease pathogenesis and in developing new approaches to diagnosis, treatment, and prevention in many areas of medicine. In Chapter 3 the potential medical impact of a detailed human genomic map is discussed further. IMPLICATIONS FOR BASIC BIOLOGY The generation of a physical map of the human genome and the determination of its nucleotide sequence will provide an important research too] for basic biology. This is especially true because we expect a human genome project to support mapping and sequencing investigations that are carried out concurrently in other extensively studied organisms, including the Escherichia cold bacterium, the lower eucaryote Saccharomyces cerevisiae (a yeasts, the nematode worm Caenorhabditis elegans, the fruit fly Drosophila melanogaster, the mouse Mus musculus, and possibly also a plant such as maize or Arabidopsis. Analyzing these genomes will approximately double the total amount of DNA to be mapped and sequenced. But the additional effort will make it possible to test the function of genes that have been identified in humans in other organisms that are experimentally accessible and for which powerful genetic techniques exist. It will thereby be possible to firmly establish the exact role of these genes in important biological processes. Conversely, proteins that are discovered to be of special interest in any of these other organisms can be immediately identified by amino acid homology in the human, thereby enabling investigators to conduct well-focused studies of the

OCR for page 23
INTROD UCTlON 23 function of the corresponding human protein and its gene. The extensive DNA sequence and functional comparisons that are gen- erated will also represent an invaluable resource for evolutionary biologists. These and other implications for basic biology are discussed in greater detail in Chapter 3. EXPECTED TECHNOLOGICAL DEVELOPMENTS GENERATED BY A HUMAN GENOME PROJECT AND THEIR IMPACT ON BIOLOGICAL RESEARCH The process of mapping and sequencing the human genome is likely to have important spin-offs in the form of new technologies with broad applicability in both basic and applied biological research. For example, efficient methods for mapping complex genomes are still being developed, and a human genome project would accelerate this process. Such methods include improvements in the production, separation, and cloning of large pieces of DNA and methods for constructing an ordered set of genomic clones (see Chapter 43. This methodology will be directly applicable to the development of a physical map of the genomes of many experimentally and commercially important animals and plants. Similarly, an effort to sequence the human genome will require much more efficient nucleotide sequencing technology than now exists (see Chapter 5~. These improvements will greatly reduce the time spent on DNA sequencing in individual research laboratories. In the future, the development of institution-wide or regional sequencing facilities equipped with highly automated instruments could serve a large number of scientists, freeing them to concentrate on more advanced stages of their research problems. Finally, the generation of a detailed map of the human genome will require new computer-based methods for collecting, storing, and analyzing the large amount of information expected (see Chapter 6~. These methods can easily be adapted to handling analogous data from other organisms. Scientists will thus have immediately available through computer networks an enormous store of biological infor- mation supported by methods for using it, such as clone collections; these resources are likely to have a major beneficial impact on the way that individual scientists do research. IMPACT ON THE RESEARCH BY SMALL GROUPS One of the key features and attractions of biomedical research today is that it is based primarily on the efforts of small, independent groups

OCR for page 24
24 MAPPING AND SEQUENCING THE HUMAN GENOME of scientists. The major advances of the past decades can be traced to the creativity of these groups, or even to single individuals, often near the beginnings of their careers. Mapping and sequencing the human genome, on the other hand, is likely to require organizational arrangements on a considerably larger scale than is customary in other biological research. Some see this as a threat to the independence of individual investigators. In the committee's view, however, a mapping and sequencing project should have as its primary goal an increase in the power and range of the research potential of small groups of indivicluals. The complete nucleotide sequences of the genomes of the several organisms of major experimental interest will provide a critical reference data base for interpreting and studying the many human genes that will be discovered. To take just one example, an individual cancer researcher who discovers a new oncogene in a human tumor will have immediate access by computer search to all the proteins that are likely to have a related function in lower organisms. Since these genes can be experimentally manipulated in ways that are impossible in humans, the function of the corresponding gene can be determined much more readily in a fruit fly, a nematode worm, or a yeast cell. The results are certain to provide important insights into human cancer that could not be obtained by direct research on humans. Conversely, researchers interested primarily in yeast cells will benefit from the information about yeast genes that can be derived from studies on its homologues that are initially conducted with another organism. Even among researchers whose efforts are confined exclusively to humans, small group efforts will be encouraged. The human genome map and an ordered set of human DNA clones will be available as a resource for the use of all investigators, enabling them to concentrate on the most interesting parts of their research. In addition, new areas of research are likely to emerge as a result of this resource, particularly in relation to human health. In short, the committee believes that the mapping and sequencing project will make an important contribution to primary research conducted by small groups of independent investigators, extending their reach into currently inaccessible prob- lems. A project to map and sequence the human genome has many different components. In the following sections of this report, we examine implications for medicine and science (Chapter 3), mapping (Chapter 4), sequencing (Chapter 5), data handling and analysis (Chapter 6), implementation and management strategies (Chapter 7), and commercial, legal, and ethical implications (Chapter 81.

OCR for page 25
INTROI:) UCTION 25 REFERENCES Alberts, B., D. Bray, J. Lewis, M. Raff, K. Roberts and J. D. Watson. 1983. Molecular Biology of the Cell. Garland, New York. 1146 pp. Alberts, B., D. Bray, J. Lewis, M. Raff, K. Roberts, and J. D. Watson. 1989. Molecular Biology of the Cell, 2nd edition, Garland, New York, in press. Doolittle, R. F., D. F. Feng, M. S. Johnson. and M. A. McClure. 1986. Relationships of human protein sequences to those of other organisms. Cold Spring Harbor Symp. Quant. Biol. 51:447-455. Egeland, J. A., I). S. Gerhard, D. L. Pauls, J. N. Sussex, K. K. Kidd, C. Allen, A. M. Hostetter, and D. E. Housman. 1987. Bipolar affective disorders linked to DNA markers on chromosome 11. Nature 325:783-787. Gusella, J. F., N. S. Wexler, P. M. Conneally, S. L. Naylor, M. A. Anderson, R. E. Tanzi, P. C. Watkins, K. Ottina, M. R. Wallace, A. Y. Sakaguchi, A. B. Young, I. Shoulson. E. Bonilla, and J. 13. Martin. 1983. A polymorphic DNA marker genetically linked to Huntington's disease. Nature 306:234-238. Lewis B. 1987. Genes, 3rd ed. John Wiley & Sons, New York. 737 pp. St George-Hyslop, P. H., R. E. Tanzi, R. J. Polinsky, J. L. Haines, L. Nee, P. C. Watkins, R. H. Myers, R. G. Feldman, D. Pollen, D. Drachman, J. Growdon, A. Bruni, J.-F. Foncin, D. Salmon, P. Frommelt, L. Amaducci, S. Sorbi, S. Piacentini, G. D. Stewart. W. J. Hobbs, P. M. Conneally, J. F. Gusella. 1987. The genetic defect causing familial Alzheimer's disease maps on chromosome 21. Science 235:885-890. Watson, J. D., J. Tooze, and D. T. Kurtz, 1983. Recombinant DNA: A Short Course. W. H. Freeman, San Francisco.

Representative terms from entire chapter:

dna molecule