CHAPTER TWO
THE EVIDENCE FOR BIOLOGICAL EVOLUTION

Many areas of science have produced support for biological evolution.

Many kinds of evidence have contributed to scientific understanding of biological evolution. Some of this evidence — such as the fossils of long-extinct animals and the geographical distribution of species — was familiar to scientists in the 19th century or earlier. Other forms of evidence — such as comparisons of DNA sequences — became available only in the 20th and 21st centuries.

The evidence for evolution comes not just from the biological sciences but also from both historical and modern research in anthropology, astrophysics, chemistry, geology, physics, mathematics, and other scientific disciplines, including the behavioral and social sciences. Astrophysics and geology have demonstrated that the Earth is old enough for biological evolution to have resulted in the species seen today. Physics and chemistry have led to dating methods that have established the timing of key evolutionary events. Studies of other species have revealed not only the physical but also the behavioral continuities among species. Anthropology has provided new insights into human origins and the interactions between biology and cultural factors in shaping human behaviors and social systems.

As in every active area of science, many questions remain unanswered. Biologists continue to study the evolutionary relationships among organisms,



The National Academies | 500 Fifth St. N.W. | Washington, D.C. 20001
Copyright © National Academy of Sciences. All rights reserved.
Terms of Use and Privacy Statement



Below are the first 10 and last 10 pages of uncorrected machine-read text (when available) of this chapter, followed by the top 30 algorithmically extracted key phrases from the chapter as a whole.
Intended to provide our own search engines and external engines with highly rich, chapter-representative searchable text on the opening pages of each chapter. Because it is UNCORRECTED material, please consider the following text as a useful but insufficient proxy for the authoritative book pages.

Do not use for reproduction, copying, pasting, or reading; exclusively for search engines.

OCR for page 17
chapter two the evidence for biological evolution Many areas of science have produced support for biological evolution. Many kinds of evidence have contributed to scientific understanding of biological evolution. Some of this evidence — such as the fossils of long- extinct animals and the geographical distribution of species — was familiar to scientists in the 19th century or earlier. Other forms of evidence — such as comparisons of DNA sequences — became available only in the 20th and 21st centuries. The evidence for evolution comes not just from the biological sciences but also from both historical and modern research in anthropology, astrophys- ics, chemistry, geology, physics, mathematics, and other scientific disciplines, including the behavioral and social sciences. Astrophysics and geology have demonstrated that the Earth is old enough for biological evolution to have resulted in the species seen today. Physics and chemistry have led to dating methods that have established the timing of key evolutionary events. Studies of other species have revealed not only the physical but also the behavioral con- tinuities among species. Anthropology has provided new insights into human origins and the interactions between biology and cultural factors in shaping human behaviors and social systems. As in every active area of science, many questions remain unanswered. Biologists continue to study the evolutionary relationships among organisms, Science, evolution, and creationiSm 17

OCR for page 17
the genetic changes that affect the form and function of organisms, the effects of organisms on Earth’s physical environment, the evolution of intelligence and social behaviors, and many other fascinating subjects. But in each case they are asking specific questions to learn more about how, not whether, evolution has occurred and is continuing to occur. They are investigating and further elucidating the mechanisms that produce evolutionary change and the consequences of that change. Biological evolution is part of a compelling historical narrative that scien- tists have constructed over the last few centuries. The narrative begins with the formation of the universe, the solar system, and the Earth, which resulted in the conditions necessary for life to evolve. While many questions remain about the origins of life on this planet, the appearance of life set in motion a process of biological evolution that continues to this day. Today, new chapters in the narrative are being uncovered through the study of the genetic processes responsible for evolutionary change. The origins of the universe, our galaxy, and our solar system produced the conditions necessary for the evolution of life on Earth. The picture of Earth’s place in the cosmos changed as much in the 20th century as it did in the 16th and 17th centuries following Copernicus’s then controver- sial suggestion that the Sun, not the Earth, was at the center of the known uni- verse. In the 1920s a new telescope at the Mount Wilson Observatory outside Los Angeles revealed that many of the faint smudges of light scattered across the night sky are not nebulae within our own Milky Way galaxy. Rather, they are separate galaxies, each containing many billions of stars. By studying the light emitted by these stars, astrophysicists arrived at another remarkable con- clusion: The galaxies are receding from each other in every direction, which implies that the universe is expanding. This observation led to the hypothesis first proposed by the Belgian astron- omer and Roman Catholic priest Georges Lemaître that the universe originated in an event known as the “Big Bang.” According to this idea, all of the energy and matter in the universe initially were compressed into an infinitesimally small, infinitely dense, and infinitely hot object known as a singularity, about which scientists still know very little. The universe then began to expand. As it did, the universe cooled to the point that the elementary particles that today form the matter of the universe became stable. The occurrence of the Big Bang, and the time that has elapsed since then, implied that matter in deep space should be at a particular temperature — a prediction confirmed by ground- Science, evolution, and creationiSm 18

OCR for page 17
For ten consecutive days, the Hubble Space Telescope focused on a small patch of sky near the Big Dipper, revealing hundreds of galaxies never seen before. based microwave radio telescopes. Later observations with satellites showed that the background radiation in the universe has exactly the properties that would be predicted from the Big Bang. A dark disk of dust As the universe expanded, the matter in it gathered, by way of gravity and and gas bisects a other processes that are not yet fully understood, into immense structures that glowing star in this photograph from became galaxies. Within these structures, much smaller clumps of matter col- the Hubble Space lapsed into whirling clouds of gas and dust. When the matter in the center of Telescope. Such disks an individual cloud became sufficiently compressed by gravity, the hydrogen appear to provide the raw materials for the atoms in that cloud began to fuse into helium atoms, giving off visible light formation of plane- and other radiation — the origin of a star. tesimals that combine Astrophysicists also have found that some stars form in the middle of a flat- to form planets and tened spinning disk of matter. The gas and dust within such disks can aggre- other orbiting bodies. gate into small grains, and these grains can form larger bodies called planetesimals. Computer simulations have indicated that planetesimals can coalesce into planets and other objects (such as moons and asteroids) orbiting a star. Our own solar system is likely to have formed in this way, and careful measurements have detected large planets orbiting stars in other parts of the Milky Way. These findings imply that billions of planets are orbiting the many billions of stars in our galaxy. Astrophysicists and geologists have developed a variety of ways to measure the ages of the universe, our galaxy, the solar system, and the Earth. By measuring Science, evolution, and creationiSm 19

OCR for page 17
the distances between galaxies and the speeds with which they are separat- ing, astronomers can calculate how much time has passed since the Big Bang. Increasingly accurate ways of measuring these quantities indicate that the universe is approximately 14 billion years old. Another way to estimate the universe’s age, using measurements of the background radiation left behind by the Big Bang, produces similar results. Other observations and calculations suggest that our galaxy began to form a few hundred million years after the Big Bang, so the Milky Way is almost as old as the universe itself. Our solar system formed within the Milky Way more recently. Measurements of radioactive elements in meteorites, which are the remnants of the materials that formed the solar system, indicate that our planet formed between 4.5 billion and 4.6 billion years ago. Asteroids and comets bombarded Earth after it formed, repeatedly melting the surface. Recent calculations show that one of Radiometric Dating [Nuclide: An atom According to modern cosmology, the particles that Some atoms are radio- constitute ordinary matter (protons, neutrons, and active, meaning that they with a particular electrons) formed when the universe cooled after naturally decay into other number of protons the Big Bang. These particles then came together radioactive and nonradio- and neutrons in its to form hydrogen atoms, helium atoms, and small active atoms by emitting nucleus. An element amounts of the next heavier element in the peri- subatomic particles and is defined by the odic table, lithium. energy. Each radioactive number of protons All the other elements in the universe were nuclide has a characteris- in its nucleus. formed inside stars like the Sun and inside tic half-life, which is the Nuclides that have exploding stars known as supernovas. Through amount of time it takes the same number of the addition of neutrons to lighter elements, for half of the atoms in a protons but different nuclear reactions produced heavier elements. sample to decay. Radio- numbers of neutrons Supernovas dispersed these elements into inter- active atoms therefore are isotopes of that stellar space. Mixed with the hydrogen, helium, act as internal clocks for element.] and lithium from the Big Bang, these elements materials. By comparing formed our solar system. the amount of a radioac- tive element in a material to the amount of its decay product, researchers can determine when the material formed. These measurements have yielded ages for the Earth, the Moon, meteor- ites, and the solar system. All of these measure- ments indicate that these objects are billions of years old. Some who oppose the teaching of evolution try to cast doubt on radiometric age measure- ments. Radiometric dating is the product of more than a century of ingenious research and represents one of the most well-substantiated achievements of modern science. Science, evolution, and creationiSm 20

OCR for page 17
the objects to hit Earth was so large — about the size of Mars — that it splashed material into Earth’s orbit that coalesced to form the Moon. The oldest rocks brought back from the Moon have ages measured to be 4.4 billion to 4.5 billion years. The oldest solid materials found on Earth are zircon crystals that formed 4.4 billion years ago. Rocks older than 3.5 billion years have been found on all the Earth’s continents. Living things appeared in the first billion years of Earth’s history. Evidence from the most ancient fossils reveals that life has existed on Earth for most of our planet’s history. Paleontologists working in Western Australia have discovered layered rocks known as stromatolites that appear to have resulted from the actions of bacteria at least 3.4 billion years ago, and fossils of cyanobacteria (also known as blue-green algae) have been determined to be nearly 3.5 billion years old. Other chemical evidence suggests that life may have originated much earlier, within a few hundred million years of when Earth’s surface finally cooled. Figuring out how life began is both an exciting and a challenging scientific problem. No fossil evidence of life forms older than 3.5 billion years has yet been found. Re-creating conditions that led to those ear- liest organisms is difficult because much remains unknown about the chemical and physical charac- Modern stromatolites teristics of the early Earth. Nevertheless, researchers formed by single-celled have been developing hypotheses of how self-replicat- organisms (inset) closely ing organisms could form and begin to evolve, and they resemble the structures have tested the plausibility of these hypotheses in laboratories. formed by some of Earth’s earliest living While none of these hypotheses has yet achieved consensus, some progress has things. been made on these fundamental questions. Since the 1950s hundreds of laboratory experiments have shown that Earth’s simplest chemical compounds, including water and volcanic gases, could have reacted to form many of the molecular building blocks of life, including the mol- ecules that make up proteins, DNA, and cell membranes. Meteorites from outer space also contain some of these chemical building blocks, and astronomers using radio telescopes have found many of these molecules in interstellar space. For life to begin, three conditions had to be met. First, groups of molecules that could reproduce themselves had to come together. Second, copies of these molecular assemblages had to exhibit variation, so that some were better able Science, evolution, and creationiSm 21

OCR for page 17
to take advantage of resources and withstand challenges in the environment. Third, the variations had to be heritable, so that some variants would increase in number under favorable environmental conditions. No one yet knows which combination of molecules first met these condi- tions, but researchers have shown how this process might have worked by [RNA: studying a molecule known as RNA. Researchers recently discovered that Ribonucleic acid. A molecule some RNA molecules can greatly increase the rate of specific chemical reactions, related to DNA that including the replication of parts of other RNA molecules. If a molecule like consists of nucleo- RNA could reproduce itself (perhaps with the assistance of other molecules), tide subunits strung it could form the basis for a very simple living organism. If such self-replica- together in chains. tors were packaged within chemical vesicles or membranes, they might have RNA serves a number formed “protocells” — early versions of very simple cells. Changes in these of cellular functions, including providing a molecules could lead to variants that, for example, replicated more efficiently in template for the syn- a particular environment. In this way, natural selection would begin to operate, thesis of proteins and creating opportunities for protocells that had advantageous molecular innova- catalyzing certain bio- tions to increase in complexity. chemical reactions.] Constructing a plausible hypothesis of life’s origins will require that many questions be answered. Scientists who study the origin of life do not yet know which sets of chemicals could have begun replicating themselves. Even if a liv- ing cell could be made in the laboratory from simpler chemicals, it would not prove that nature followed the same pathway billions of years ago on the early Earth. But the principles underlying life’s chemical origins, as well as plau- sible chemical details of the process, are subject to scientific investigation in the same ways that all other natural phenomena are. The history of science shows that even very difficult questions such as how life originated may become amenable to solution as a result of advances in theory, the development of new instrumentation, and the discovery of new facts. The fossil record provides extensive evidence documenting the occurrence of evolution. Early in the 19th century, naturalists observed that fossils occur in a particular [Sedimentary: order in layers of sedimentary rock. Older materials are deposited more deeply Rocks formed of and thus lie closer to the bottom of sedimentary rock than more recently depos- particles deposited ited sediments, although older rocks can sometimes lie above younger rocks by water, wind, where large upheavals in the Earth’s crust have taken place. or ice.] Fossils that closely resemble contemporary organisms appear in relatively young sediments, while fossils that only distantly resemble contemporary organisms occur in older sediments. Based on these observations, many naturalists, including Charles Darwin’s grandfather, proposed that organisms had changed over time. But Darwin and Alfred Russel Wallace were the first Science, evolution, and creationiSm 22

OCR for page 17
to identify natural selection as the driving force behind evolution, or what Darwin termed “descent with modification.” When Darwin published On the Origin of Species in 1859, paleontology was still a rudimentary science. Sedimentary rocks from many time periods were unknown or had been inadequately studied. Darwin spent almost 20 years gathering evidence that supported his idea before making it public, but he also carefully considered evidential problems for his view, such as the inad- equacy of the fossil record A near complete skel- and the rarity of intermedi- eton of a transitional bird-like fossil that was ate forms between some discovered in China major groups of organisms and reported in 2006. at that time. In the century and a half since then, paleontologists have found many interme- diate forms that were not known in Darwin’s time. In a variety of locations, sedimentary rocks that are between 540 million and 635 million years old contain traces of soft-bodied multi- cellular organisms, and fossilized tracks in earlier sediments hint at the existence of wormlike creatures as long ago as 1 billion years. Some of these organisms are likely to be the intermediate forms between the single-celled organisms that were Earth’s sole inhabitants for the first 2 or more billion years of life’s history and the hard-bodied organisms that appear in abundance in the fossil record beginning about 540 million years ago. Similarly, many of the organisms that appeared during this period were transitional forms between earlier soft-bodied organisms and major evolutionary lineages such as the fishes, arthropods, and mollusks that have survived to the present day. As described at the beginning of this document, Tiktaalik is a notable transi- tional form between fish and the early tetrapods that lived on land. Fossils from about 330 million years ago document the evolution of large amphibians from the early tetrapods. Well-preserved skeletons from rocks that are 230 million years old show dinosaurs evolving from a lineage of reptiles. A long-standing example of a transitional form is Archaeopteryx, a 155-million-year-old fossil that has the skeleton of a small dinosaur but also feathers and wings. More birdlike fossils from China that are about 110 million years old have smaller tails and clawed appendages. In the more recent fossil record, the evolutionary paths of many modern organisms, such as whales, elephants, armadillos, horses, and humans, have been uncovered. Science, evolution, and creationiSm 23

OCR for page 17
Common structures and behaviors often demonstrate that species have evolved from common ancestors. Each species that lives on Earth today is the product of an evolutionary lineage — that is, it arose from a preexisting species, which itself arose from a preexist- ing species, and so on back through time. For any two species living today, their evolutionary lineages can be traced back in time until the two lineages intersect. At that intersection is the spe- cies that was the most recent common ancestral species of the two modern spe- cies. (Sometimes, this common ancestral species is referred to as the common ancestor, but this term refers to a group of organisms rather than to a single ances- tor.) For example, the common ancestor of humans and chimpanzees was a spe- cies estimated to have lived 6 to 7 million years ago, whereas the common ances- tor of humans and the puffer fish was an ancient fish that lived in the Earth’s oceans more than 400 million years ago. Thus, humans are not descended from chimpanzees or from any other ape living today but from a species that no longer exists. Nor are humans descended from Modern chimpanzees, other great apes, and the species of fish that live today but, rather, from the species of fish that gave humans are descended rise to the early tetrapods. from a common If the common ancestor of two species lived relatively recently, those two ancestor that is now species are likely to have more physical features and behaviors in common extinct. than two species with a more distant common ancestor. Humans are thus far more similar to chimps than they are to fish. Nevertheless, all organisms share some common traits because they all share common ancestors at some point in the past. For example, based on accumulating fossil and molecular evidence, the common ancestor of humans, cows, whales, and bats was likely a small mammal that lived about 100 million years ago. The descendants of that common ancestor have undergone major changes, but their skeletons remain strikingly similar. A person writes, a cow walks, a whale swims, and a bat flies with structures built of bones that are different in detail but similar in general structure and relation to each other. Evolutionary biologists call similar structures that derive from common ancestry “homologies.” Comparative anatomists investigate such homologies, not only in bone structure but also in other parts of the body, and work out Science, evolution, and creationiSm 24

OCR for page 17
The last common ances- tor of all monkeys and apes lived about 40 mil- lion years ago. Proconsul was a species that lived about 17 million years ago. The most recent species ancestral to both humans and chimpan- zees lived 6 to 7 million years ago. evolutionary relationships from degrees of similarity. Using the same logic, other biologists examine similarities in the functions of different organs, in the development of embryos, or in behaviors among different kinds of organisms. Though dolphins (left) are more closely These investigations provide evidence about the evolutionary pathways that related to humans connect today’s organisms to their common ancestors. Hypotheses based on than they are to this evidence then can be tested by examining the fossil record. sharks (right), they Sometimes, separate lineages independently evolve similar features, known have evolved bodies adapted to an aquatic as “analogous” structures, which look like homologies but result from common environment. This is environments rather than common ancestry. For example, dolphins are aquatic an example of analo- mammals that have evolved from terrestrial mammals over the past 50 million gous structures. Science, evolution, and creationiSm 25

OCR for page 17
Radius Ulna Carpals Metacarpals Phalanges Whale Human Dog The bones in the fore- Bird limbs of terrestrial and some aquatic verte- brates are remarkably Humerus similar because they have all evolved from the forelimbs of a com- Radius mon ancestor. This is an Ulna example of homologous Carpals structures. Metacarpals Phalanges Whale Bird years. In evolutionary terms, dolphins are as distant from fish as are mice or humans. But they have evolved streamlined bodies that closely resemble the bodies of fish, sharks, and even extinct dinosaurs known as ichthyosaurs. These kinds of evidence from many different fields of biology allow evolution- ary biologists to discern whether physical and behavioral similarities are the product of common descent or are independent responses to similar environ- mental challenges. Evolution accounts for the geographic distribution of many plants and animals. The diversity of life is almost unimaginable. Many millions of species live on, in, and above the Earth, each occupying its own ecological setting or niche. Some species, such as humans, dogs, and rats, can live in a wide range of envi- The volcanic birth of the Hawaiian Islands ronments. Others are extremely specialized. One species of a fungus grows in the Pacific Ocean exclusively on the rear portion of the covering on the wings of a single species over 2,000 miles from of beetle that is found only the nearest continent in some caves in southern allowed one or a small number of windblown France. The larvae of the drosophilid flies such fly Drosophila carcinophila as the example pic- can develop only in special- tured to evolve into ized grooves beneath the more than 500 species in the islands’ special- flaps of the third pair of oral ized environments. appendages of a land crab This rampant specia- that is found solely on certain tion was made pos- sible in part because islands in the Caribbean. many of the environ- The occurrence of biologi- ments in which they cal evolution both explains evolved were largely this diversity and accounts free of insect competi- tors and predators. for its distribution. Consider, Science, evolution, and creationiSm 26

OCR for page 17
for example, the drosophilid flies of the Hawaiian Islands. More than 500 species of flies belonging to the genera Drosophila and the closely related Scaptomyza exist only in Hawaii. These Hawaiian species comprise about a quarter of all the species in these genera worldwide, and far more species than are found in a similar-sized area anywhere else on Earth. Why do so many dif- ferent kinds of flies live exclusively in Hawaii? The geological and biological history of Hawaii provides an answer. The Hawaiian Islands consist of the tops of mid-ocean volcanoes and have never been connected to any body of land. The islands formed as the Pacific tectonic plate moved over a “hot spot” where upwelling molten rock from the Earth’s interior heats the Earth’s crust. The newest islands are the tallest, while older islands progressively erode and eventually sink beneath the water. Thus, the oldest landmass in the chain, Kure Atoll, rose from the Pacific about 30 mil- lion years ago, while the youngest, the “Big Island” of Hawaii, is only about 500,000 years old and still has considerable ongoing volcanic activity. All of the native plants and animals of the Hawaiian Islands — that is, those existing on the islands before the arrival of humans 1,200 to 1,600 years ago — are descended from organisms that made their way through the air or the water from the surrounding continents and from distant islands to the ini- tially barren islands. In the case of the Hawaiian drosophilids, several lines of evidence, especially from DNA, indicate that all of the native Drosophila and Scaptomyza species are descended from a single ancestral species that colonized the islands millions of years ago. These initial colonizers encountered conditions that were very favorable [Speciation: The to rapid speciation. Individual species repeatedly served as ancestors for evolutionary processes multiple other species as groups of flies occupied habitats with different eleva- through which new tions, precipitation, soils, and plants. In addition, small groups of flies — or species arise from in some cases perhaps a single fertilized female — periodically flew or were existing species.] carried to other islands, where they gave rise to new species. Many new spe- cies were able to occupy ecological niches that on the continents already would have been filled by other species. For example, many Hawaiian drosophilids lay eggs in decaying leaves on the ground, an ecological niche that is filled by insects and other organisms on the continents but in the Hawaiian Islands was almost empty. The mammals that have lived in North and South America provide another good example of how evolution accounts for the distribution of species. These two continents were connected as part of a much larger landmass during the early evolution of the mammals. But the breakup of that landmass caused North and South America to separate, after which their respective mammals evolved in different directions. The mammals that evolved in South America include such modern-day groups as anteaters, sloths, opossums, and armadil- los, according to the fossil record. In North America, horses, bats, wolves, and Science, evolution, and creationiSm 27

OCR for page 17
When tectonic forces joined North and South America, mammals that had evolved in South America, such as the armadillo, migrated north. the saber-toothed cat were among the many species that evolved. Then, about 3 million years ago, North and South America were reconnected as a conse- quence of the movement of the Earth’s tectonic plates. Mammals of South American origin, such as armadillos, porcupines, and opossums, migrated north. Meanwhile, many kinds of North American mammals, including deer, raccoons, mountain lions, bears, and dogs, eventually made their way across the isthmus to the south. Molecular biology has confirmed and extended the conclusions about evolution drawn from other forms of evidence. Charles Darwin and other 19th-century biologists arrived at their conclusions despite knowing almost nothing about the molecular basis of life. Since then, the ability to examine biological molecules in detail has provided an entirely new form of evidence about the mechanisms and historical pathways of evolu- tion. This new evidence has fully confirmed the general conclusions drawn from the fossil record, the geographic distribution of species, and other types of observations. In addition, it has provided a wealth of new information about the evolutionary relationships among species and about how evolution occurs. DNA is passed from one generation to the next directly from a parent to its offspring (in asexually reproducing organisms) or through the union of DNA-containing sperm and egg cells (in sexually reproducing organisms). As discussed earlier, the sequence of nucleotides in DNA can change from one generation to the next because of mutations; if these changes give rise to ben- eficial traits, the new DNA sequences are likely to spread within a population Science, evolution, and creationiSm 28

OCR for page 17
The Picture-Winged Drosophilids The drosophilid flies of Hawaii provide an excellent banding patterns make it especially easy to example of ”adaptive radiation,” in which an ances- detect a kind of chromosomal rearrangement tral species gives rise to a very large number of new known as an inversion. Sometimes, a mistake species in a relatively short time. during the duplication of DNA can cause a [Chromosome: Evolutionary biologists have segment of the chromosome to be flipped. A double stranded focused particular attention on The result is a rearranged chromosome in DNA molecule that a group of about 100 drosophi- which a section of the chromosome, with contains a series of lid species that have characteris- its characteristic light and dark bands, has a specific genes along tic pigmented markings on their reversed orientation. Many inversions of this its length. In most large wings. Known as the pic- type have occurred in different segments of sexually reproduc- ture-winged drosophilids, these chromosomes in different species of flies. ing organisms, species carry within them a As individual species of drosophilids on the chromosomes occur remarkable biological record of Hawaiian islands have diversified to form mul- in pairs, with one the group’s evolutionary history. tiple species, researchers have used the result- member of the pair Cells in the salivary glands ing changes in banding patterns to reconstruct being inherited of all Drosophila larvae contain the sequence in which existing species of dro- from each parent.] special chromosomal structures sophilids moved from older islands to newer known as polytene chromo- islands and gave rise to new species. For somes. Easily visible through a microscope, these example, the “Big Island“ of Hawaii, which polytene chromosomes display hundreds of alternat- is the youngest in the island chain, currently ing dark and light bands of different sizes. These has 26 species of picture-winged drosophilids. By examining the specific chromosome inversions in these colonizing species and comparing them with species that live on islands that are older, researchers have determined that flies on the Big Island Photograph of a polytene chromosome from a Drosophila have all originated from 19 separate coloniza- larva shows two breakpoints (indicated by solid bars) where a portion of the chromosome is inverted compared to the tions of the island by a small group of flies (or same chromosome in other species. perhaps single fertilized female flies) from one of the older islands. over multiple generations. In addition, neutral mutations that have no effect on the traits of an organism can be maintained within a population as DNA passes between generations. As a result, DNA contains a record of past genetic changes, including the changes responsible for evolutionary adaptations. By comparing the DNA sequences of two organisms, biologists can uncover the genetic changes that have occurred since those organisms shared a com- mon ancestor. If two species have a relatively recent common ancestor, their DNA sequences will be more similar than the DNA sequences for two species that share a distant common ancestor. For example, the DNA sequences of humans, which vary to a small degree among individuals and populations Science, evolution, and creationiSm 29

OCR for page 17
100% The gene that, when chimpanzee 50% mutated, causes cys- orangutan degree of tic fibrosis in humans similarity is very similar to the baboon with human nucleotide corresponding gene marmoset sequences in chimpanzees but lemur is less similar to the corresponding gene mouse in organisms that are chicken less closely related to puffer fish humans. The height of the green bars 100 nucleotide pairs shows the similarity of the gene in other 10,000 nucleotide pairs organisms to the human gene over a span of 10,000 of people, on average differ by just a few percent from those of chimpanzees, nucleotides. reflecting our relatively recent common ancestry. But human DNA sequences are increasingly different from those of the baboon, mouse, chicken, and puffer fish, reflecting our increasing evolutionary distance from each of those organ- isms. Even greater differences in DNA sequences are found when comparing humans to flies, worms, and plants. Yet similarities in DNA sequences can be MBoC5 4.465/4.81 seen across all living forms, despite the amount of time that has elapsed since The Evolution of Limbs in Early Tetrapods Molecular biologists have been discovering DNA regions that control the formation of body parts during development. Some of the most important of these DNA regions are known as Hox genes. Humans and all other mammals have 39 Hox genes. Individual Hox genes control the function of other types of genes, and the same Hox gene can control different sets of genes in different parts of the body. Hox genes are also involved in the develop- ment of many different anatomical features, including limbs, the spine, the digestive system, and the reproductive tract in diverse species of both invertebrate and vertebrate animals. For example, as illustrated in the figure (right Hox genes also direct the formation of fins in fish side of page), the same Hox genes that control and limbs in land-dwelling vertebrates. They are the development of body parts in the fruit fly expressed in different patterns in limbed animals, Drosophila also control the development of body resulting in the formation of fingers and toes. Changes parts in mice and other mammals. Colors indicate in the expression of these genes were likely involved in the activity of the same Hox gene in both kinds the evolution of the early tetrapods, such as Tiktaalik. of organisms. Science, evolution, and creationiSm 30

OCR for page 17
Comparison of the human gorilla A and chimp DNA sequences for the gene that encodes human GTGCCCATCCAAAAAGTCCAAGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGG the hormone leptin (which chimp GTGCCCATCCAAAAAGTCCAGGATGACACCAAAACCCTCATCAAGACAATTGTCACCAGG is involved in the metabo- lism of fats) reveals only five differences in 250 nucleotides. Where the human ATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAAAGTCACCGGTTTGGAC human and chimpanzee sequences differ, the corre- chimp ATCAATGACATTTCACACACGCAGTCAGTCTCCTCCAAACAGAAGGTCACCGGTTTGGAC sponding nucleotide in the gorilla gorilla (shaded bars) can be G used to derive the nucleo- gorilla C tide that likely existed in human TTCATTCCTGGGCTCCACCCCATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTC the common ancestor of humans, chimpanzees, chimp TTCATTCCTGGGCTCCACCCTATCCTGACCTTATCCAAGATGGACCAGACACTGGCAGTC and gorillas. In two cases, the gorilla and human nucleotides match, while in the other three cases, human TACCAACAGATCCTCACCAGTATGCCTTCCAGAAACGTGATCCAAATATCCAACGACCTG the gorilla and chimpanzee sequences are the same. chimp TACCAACAGATCCTCACCAGTATGCCTTCCAGAAACATGATCCAAATATCCAACGACCTG The common ancestor of gorilla A the gorilla, chimpanzee, and human is most likely to have had the nucleotide human GAGAACCTCCGGGATCTTCTTCAGGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGG that is the same in two of the three modern-day chimp GAGAACCTCCGGGACCTTCTTCAGGTGCTGGCCTTCTCTAAGAGCTGCCACTTGCCCTGG organisms because this gorilla C would require just one DNA change rather than two. they had common ancestors. Even humans and bacteria share some similarity in DNA sequences in certain genes, and these similarities correspond to molecu- lar systems with similar functions. Biological evolution thus explains why other organisms can be studied to understand biological processes critical to human life. Indeed, much of the biomedical research carried out today is based on the biological commonalities of all living things. The study of biological molecules has done more than document the evolu- tionary relationships among organisms. It also can reveal how genetic changes produce new traits in organisms over the course of evolutionary history. For example, molecular biologists have been examining the function of regula- tory proteins that cause other genes in a cell to turn on and off as an organism develops from a fertilized egg. Small changes in these proteins, in the DNA regions to which these proteins attach, or even, as recently discovered, in small RNA molecules can have dramatic effects on the anatomy and function of an MBOC5 m7.109/4.74 organism. Such changes could be responsible for some of the major evolu- tionary innovations that have occurred over time, such as the development Science, evolution, and creationiSm 31

OCR for page 17
of limbs from fins in early tetrapods. Moreover, biologists have discovered that very similar sets of regulatory proteins occur in organisms as different as flies, mice, and humans, despite the many millions of years that separate these organisms from their common ancestors. The DNA evidence suggests that the basic mechanisms controlling biological form became established before or dur- ing the evolution of multicellular organisms and have been conserved with little modification ever since. Biological evolution explains the origin and history of our species. Study of all the forms of evidence discussed earlier in this booklet has led to the conclusion that humans evolved from ancestral primates. In the 19th cen- tury, the idea that humans and apes had common ancestors was a novel one, and it was hotly debated among scientists in Darwin’s time and for years after. The Evolution of Whales, Dolphins, and Porpoises The combination of fossil and molecular evidence enables biologists to construct much more detailed evolutionary histo- ries than have been possible in the past. For example, recent fossil discoveries in Asia have revealed a succession of organisms that, Fossils of Dorudon, found in Egypt and dating to beginning about 50 million years ago, moved from life approximately 40 million years ago, document a critical transition in the evolution of modern whales. on land first to hunt and then to live continuously in Because it had evolved from a mammal that lived on marine environments. This fossil evidence accords with land, Dorudon still had vestigial traces of hind limbs, recent genetic findings that whales, dolphins, and por- feet, and toes (the small bones at the base of the poises are descended from a group of terrestrial mam- tail), even though it lived in the water and used its mals known as artiodactyls, which today includes such long powerful tail to swim. animals as sheep, goats, and giraffes. Most recently, studies of regulatory networks in the DNA of modern porpoises have revealed the molecular changes that caused the ancestors of these organisms to lose their hind limbs and develop more streamlined bodies. All of these forms of evidence support each other and add fascinating details to the understanding of evolution. Science, evolution, and creationiSm 32

OCR for page 17
More than 3.5 million years ago, two hominids walked upright across a field of newly fallen volcanic ash in eastern Africa. The footprints were covered by a subsequent ashfall until 1978, when they were unearthed by paleontologists. The Laetoli footprints, named after the site where they were found, are very early evidence of upright walking, a key acquisition in the lin- eage leading to humans. But today there is no scientific doubt about the close evolutionary relation- ships between humans and all other primates. Using the same scientific methods and tools that have been employed to study the evolution of other species, researchers have compiled a large and increasing number of fossil discoveries and compelling new molecular evidence that clearly indicate that the same forces responsible for the evolution of all other life forms on Earth account for the biological evolution of human characteristics. Based on the strength of evidence from DNA comparisons, the common ancestor of humans and chimpanzees lived approximately 6 to 7 million years ago in Africa. The evolutionary tree leading from this ancestral species to modern humans contains a number of side branches, representing popula- tions and species that eventually went extinct. At various times in the past, the planet appears to have been populated by several human-like species. About 4.1 million years ago, a species appeared in Africa that paleontolo- gists place in the genus Australopithecus, which means “southern ape.” (A member of the genus was first discovered in southern Africa, although other fossils, including an almost complete skeleton of a 3-year-old female, have been found in eastern Africa.) The brain of an adult of this genus was about the same size as that of modern apes (as documented by the size of fossil Science, evolution, and creationiSm 33

OCR for page 17
In the drawing at right, the skeleton of Lucy, exemplar of an adult member of the spe- cies Australopithecus afarensis (with shaded bones representing those that were recov- ered), dates from the same geological period when the Laetoli foot- prints were made. For comparison, the skele- ton of a modern human stands beside her. skulls), and it appears to have spent part of its life climbing in trees, as indi- cated by its short legs and features of its upper limbs. But Australopithecus also walked upright, as humans do. Footprints left by one of the earliest Australopithecus species have been discovered preserved with remarkable clarity in hardened volcanic ash. About 2.3 million years ago, the earliest species of Homo, the genus to which all modern humans belong, evolved in Africa. This species is known as Homo habilis (“handy” or “skillful man”). Its average brain size, as deter- mined from skulls that postdate 2 million years ago, was probably about 50 percent larger than that of earlier Australopithecus. The earliest stone tools appear about 2.6 million years ago. About 1.8 million years ago, a more evolved species, Homo erectus (“upright man”) appeared. This species spread from Africa to Eurasia. The subsequent fossil record includes the skeletal remains of additional species within the genus Homo. The more recent species generally had larger brains than the earlier ones. Science, evolution, and creationiSm 34

OCR for page 17
A number of species, of which only Australopithecus afarensis, Homo habilis, and Homo erectus are shown here, are thought to represent evolutionary links between mod- ern humans and the more ancient species that was the common ancestor of chimpan- zees, bonobos (a close relative of chimpan- zees), and modern humans. Other closely related species on the human side of the family tree are known from the fossil record. Paranthropus robustus and Neanderthals are extinct evolutionary lineages now repre- sented only by fossils. Evidence shows that anatomically modern humans (Homo sapiens —“wise” or “knowing man”) with bodies and brains like ours, evolved in Africa from earlier forms of humans. The earliest known fossil of a modern human is less than 200,000 years old. The members of this group dispersed throughout Africa and, more recently, into Asia, Australia, Europe, and the Americas, replacing earlier populations of humans then living in some parts of the world. ■ Science, evolution, and creationiSm 35

OCR for page 17