Regenerative Medicine (2003) / Chapter Skim
Currently Skimming:
10 Genetic and functional differences between multipotent neural and pluripotent embryonic stem cells
10 Genetic and functional differences between multipotent neural and pluripotent embryonic stem cells
Pages 50-56
The Chapter Skim interface presents what we've algorithmically identified as the most significant single chunk of text within every page in the chapter.
Select key terms on the right to highlight them within pages of the chapter.
From page 50... ...
, using the Sox2 promoter for isolation of purified populations by fluorescence-activated cell sorting. A stringent expression profile comparison of promoterdefined NSCs and ESCs revealed a striking dissimilarity, and subsequent chimera analyses confirmed the fundamental differences in cellular potency between these populations.
|
From page 51... ...
These methods tend GACC and reverse 5'-TGAAGAACAGCCTCGACAACAT; to complement each other because they each rely on different Zicl, forward 5'-(51AAAACAGAGGAGGUAGUAAG and sets of assumptions. Using multiple methods generates a list of reverse 5'-AAAGACCACCACGCCACGAT; Mytl, forward 5' differentially expressed genes of extremely high confidence CAGTGTCTCCTATGATGTCCTC and reverse 5'-GGCTG because of the requirement that the gene be detected as differ- CAAACTCCAAAACTTCC; Gapdh, forward 5'-ACCA ential by multiple, independent data analysis methods.
|
From page 52... ...
The availability of P/Sox2 as a common molecular identifier for both ESCs and NSCs allows for their isolation and thereby permits a direct transcriptional profiling comparison between pluripotent and multipotent SCs, respectively. An overview of the experimental design for transcriptional profiling, as well as some of the observed transcripts that one might expect, is illustrated in Fig.
|
From page 53... ...
This difference amounts to 666 genes at the level of 1.4-fold change and 269 at 2.0-fold (Table 1, Pluripotent) , each detected with at least Category n= 112 Pluripotent-specific n= 158 Multipotent-specific Transcriptional regulation Chromatin modulation RNA binding Growth factors Receptors Kinases and phophotases Cell cycle Other signaling molecules Metabolism Cell adhesion Cytoskeleton Toxic response Vesicle traffic Other 21 o 4 4 5 Oct4, Utfl, Rex1/2, Klf2/5, NrOb1, Crtr1, Pem, Stat6, Tcf7/15, Rarg, El/2, Trim25, Tcea3, Aire, Gbx2, ESTs highly similar to Tbx3, ESTs moderately similar to Znf41, ESTs weakly similar to N kx2.5 None detected Esg1, Rbms1, Dazl, ESTs similar to Rbpms Fgf4, Tdgf1, Ebaf, Gdf3 F2r/1 (thrombin it-like 1)
|
From page 54... ...
Transcription factors were chosen for the first level of analysis because of their commonly described roles in regulation of cell fates and differentiation. As might be expected, the gene encoding the transcription factor Oct4 is at the top of the list with regard to fold change, because it is highly expressed in ESCs and absent from NSCs.
|
From page 55... ...
This assay functionally demonstrates the multipotent and pluripotent character of the P/Sox2-defined NSC and ESC populations, respectively, and validates the differentially expressed genes as potential molecular correlates of this functional difference. Recently, two other groups have reported expression profiling comparisons between ESCs and multipotent SCs (30, 314.
|
From page 56... ...
20. Hogan, B
|
Key Terms
This material may be derived from roughly machine-read images, and so is provided only to facilitate research.
More
information on Chapter Skim is available.